EMAIL THIS PAGE TO A FRIEND

GCAT

glycine C-acetyltransferase

55 Gene Product Result for
Synonyms: KBL
UniProtKB ID: O75600, E2QC23, Q6ZWF1, Q96CA9
Gene ID:
Human(23464) Summary: The degradation of L-threonine to glycine consists of a two-step biochemical pathway involving the enzymes L-threonine dehydrogenase and 2-amino-3-ketobutyrate coenzyme A ligase. L-Threonine is first converted into 2-amino-3-ketobutyrate by L-threonine dehydrogenase. This gene encodes the second enzyme in this pathway, which then catalyzes the reaction between 2-amino-3-ketobutyrate and coenzyme A to form glycine and acetyl-CoA. The encoded enzyme is considered a class II pyridoxal-phosphate-dependent aminotransferase. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 14. [provided by RefSeq, Jan 2010]
Mouse(26912) glycine C-acetyltransferase (2-amino-3-ketobutyrate-coenzyme A ligase)
Rat(366959) glycine C-acetyltransferase
sheep(101102469) glycine C-acetyltransferase
Domestic Rabbit(100353494) glycine C-acetyltransferase
domestic guinea pig(100723646) glycine C-acetyltransferase
naked mole-rat(101716933) glycine C-acetyltransferase
Zebrafish(402822) glycine C-acetyltransferase
cow(319141) glycine C-acetyltransferase
Horse(100069889) glycine C-acetyltransferase
domestic cat(101098880) glycine C-acetyltransferase
chicken(427905) glycine C-acetyltransferase
dog(481262) glycine C-acetyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014291 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014291 Rosetta Predictions human pricing
NM_001024277 Rosetta Predictions rat pricing
NM_013847 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012564 predicted 889
2 SASI_Hs01_00012565 predicted 936
3 SASI_Hs01_00012566 predicted 351
4 SASI_Hs01_00012567 predicted 656
5 SASI_Hs01_00012568 predicted 998
6 SASI_Hs01_00012569 predicted 536
7 SASI_Hs01_00012570 predicted 462
8 SASI_Hs01_00012571 predicted 311
9 SASI_Hs01_00012572 predicted 206
10 SASI_Hs01_00012573 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064049 predicted 280
2 SASI_Rn01_00064050 predicted 277
3 SASI_Rn02_00202455 predicted 602
4 SASI_Rn01_00064051 predicted 315
5 SASI_Rn01_00064052 predicted 266
6 SASI_Rn01_00064053 predicted 492
7 SASI_Rn01_00064054 predicted 969
8 SASI_Rn02_00202456 predicted 596
9 SASI_Rn02_00202457 predicted 373
10 SASI_Rn01_00064055 predicted 643
11 SASI_Rn01_00064056 predicted 418
12 SASI_Rn01_00064057 predicted 1084
13 SASI_Rn01_00064058 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140938 predicted 1077
2 SASI_Mm01_00140939 predicted 1103
3 SASI_Mm01_00140940 predicted 1358
4 SASI_Mm01_00140941 predicted 418
5 SASI_Mm01_00140942 predicted 205
6 SASI_Mm02_00322852 predicted 282
7 SASI_Mm01_00140944 predicted 299
8 SASI_Mm01_00140945 predicted 684
9 SASI_Mm01_00140946 predicted 1340
10 SASI_Mm01_00140947 predicted 472
11 SASI_Mm01_00140943 predicted 618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013847
GCAT MISSION shRNA Bacterial Glycerol Stock
glycine C-acetyltransferase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013847.2-1747s1c1
Sequence:CCGGCCCAGAAAGAAGAAAGCAGATCTCGAGATCTGCTTTCTTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013847.2-1115s1c1
Sequence:CCGGGTATCTTTGTCATCGGATTTACTCGAGTAAATCCGATGACAAAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013847.2-351s1c1
Sequence:CCGGAGAAGCCAAGATAGCCCACTTCTCGAGAAGTGGGCTATCTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013847.2-299s1c1
Sequence:CCGGGACTCAGTTCTACTCGATTTACTCGAGTAAATCGAGTAGAACTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013847.2-297s1c1
Sequence:CCGGTGGACTCAGTTCTACTCGATTCTCGAGAATCGAGTAGAACTGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013847.3-1114s21c1
Sequence:CCGGGTATCTTTGTCATCGGATTTACTCGAGTAAATCCGATGACAAAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013847.3-296s21c1
Sequence:CCGGTGGACTCAGTTCTACTCGATTCTCGAGAATCGAGTAGAACTGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013847.3-1746s21c1
Sequence:CCGGCCCAGAAAGAAGAAAGCAGATCTCGAGATCTGCTTTCTTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013847.3-350s21c1
Sequence:CCGGAGAAGCCAAGATAGCCCACTTCTCGAGAAGTGGGCTATCTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013847
GCAT MISSION shRNA shRNA Plasmid DNA
glycine C-acetyltransferase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013847.2-1747s1c1
Sequence:CCGGCCCAGAAAGAAGAAAGCAGATCTCGAGATCTGCTTTCTTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013847.2-1115s1c1
Sequence:CCGGGTATCTTTGTCATCGGATTTACTCGAGTAAATCCGATGACAAAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013847.2-351s1c1
Sequence:CCGGAGAAGCCAAGATAGCCCACTTCTCGAGAAGTGGGCTATCTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013847.2-299s1c1
Sequence:CCGGGACTCAGTTCTACTCGATTTACTCGAGTAAATCGAGTAGAACTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013847.2-297s1c1
Sequence:CCGGTGGACTCAGTTCTACTCGATTCTCGAGAATCGAGTAGAACTGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013847.3-1114s21c1
Sequence:CCGGGTATCTTTGTCATCGGATTTACTCGAGTAAATCCGATGACAAAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013847.3-296s21c1
Sequence:CCGGTGGACTCAGTTCTACTCGATTCTCGAGAATCGAGTAGAACTGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013847.3-1746s21c1
Sequence:CCGGCCCAGAAAGAAGAAAGCAGATCTCGAGATCTGCTTTCTTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013847.3-350s21c1
Sequence:CCGGAGAAGCCAAGATAGCCCACTTCTCGAGAAGTGGGCTATCTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013847
GCAT MISSION shRNA Lentiviral Transduction Particles
glycine C-acetyltransferase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013847.2-1747s1c1
Sequence:CCGGCCCAGAAAGAAGAAAGCAGATCTCGAGATCTGCTTTCTTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013847.2-1115s1c1
Sequence:CCGGGTATCTTTGTCATCGGATTTACTCGAGTAAATCCGATGACAAAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013847.2-351s1c1
Sequence:CCGGAGAAGCCAAGATAGCCCACTTCTCGAGAAGTGGGCTATCTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013847.2-299s1c1
Sequence:CCGGGACTCAGTTCTACTCGATTTACTCGAGTAAATCGAGTAGAACTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013847.2-297s1c1
Sequence:CCGGTGGACTCAGTTCTACTCGATTCTCGAGAATCGAGTAGAACTGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013847.3-1114s21c1
Sequence:CCGGGTATCTTTGTCATCGGATTTACTCGAGTAAATCCGATGACAAAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013847.3-296s21c1
Sequence:CCGGTGGACTCAGTTCTACTCGATTCTCGAGAATCGAGTAGAACTGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013847.3-1746s21c1
Sequence:CCGGCCCAGAAAGAAGAAAGCAGATCTCGAGATCTGCTTTCTTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013847.3-350s21c1
Sequence:CCGGAGAAGCCAAGATAGCCCACTTCTCGAGAAGTGGGCTATCTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014291
VALIDATED
GCAT MISSION shRNA Bacterial Glycerol Stock
glycine C-acetyltransferase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_014291.2-221s1c1
Sequence:CCGGCCTTAACTTCTGTGCCAACAACTCGAGTTGTTGGCACAGAAGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014291.2-1115s1c1
Sequence:CCGGCATGCTGAAGAGAGGCATCTTCTCGAGAAGATGCCTCTCTTCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_014291.2-328s1c1
Sequence:CCGGGCTTTATCTGTGGAACCCAGACTCGAGTCTGGGTTCCACAGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_014291.2-345s1c1
Sequence:CCGGCAGAGCATCCACAAGAATCTACTCGAGTAGATTCTTGTGGATGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014291.3-715s21c1
Sequence:CCGGTGCTGCCTCGCCTCTAGATATCTCGAGATATCTAGAGGCGAGGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014291.3-1247s21c1
Sequence:CCGGTGCATAGCGAGGAAGACATTGCTCGAGCAATGTCTTCCTCGCTATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014291.3-531s21c1
Sequence:CCGGGCTGAACCATGCCTCCATCATCTCGAGATGATGGAGGCATGGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014291
VALIDATED
GCAT MISSION shRNA shRNA Plasmid DNA
glycine C-acetyltransferase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_014291.2-221s1c1
Sequence:CCGGCCTTAACTTCTGTGCCAACAACTCGAGTTGTTGGCACAGAAGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014291.2-1115s1c1
Sequence:CCGGCATGCTGAAGAGAGGCATCTTCTCGAGAAGATGCCTCTCTTCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_014291.2-328s1c1
Sequence:CCGGGCTTTATCTGTGGAACCCAGACTCGAGTCTGGGTTCCACAGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_014291.2-345s1c1
Sequence:CCGGCAGAGCATCCACAAGAATCTACTCGAGTAGATTCTTGTGGATGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014291.3-715s21c1
Sequence:CCGGTGCTGCCTCGCCTCTAGATATCTCGAGATATCTAGAGGCGAGGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014291.3-1247s21c1
Sequence:CCGGTGCATAGCGAGGAAGACATTGCTCGAGCAATGTCTTCCTCGCTATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014291.3-531s21c1
Sequence:CCGGGCTGAACCATGCCTCCATCATCTCGAGATGATGGAGGCATGGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014291
VALIDATED
GCAT MISSION shRNA Lentiviral Transduction Particles
glycine C-acetyltransferase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_014291.2-221s1c1
Sequence:CCGGCCTTAACTTCTGTGCCAACAACTCGAGTTGTTGGCACAGAAGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014291.2-1115s1c1
Sequence:CCGGCATGCTGAAGAGAGGCATCTTCTCGAGAAGATGCCTCTCTTCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_014291.2-328s1c1
Sequence:CCGGGCTTTATCTGTGGAACCCAGACTCGAGTCTGGGTTCCACAGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_014291.2-345s1c1
Sequence:CCGGCAGAGCATCCACAAGAATCTACTCGAGTAGATTCTTGTGGATGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014291.3-715s21c1
Sequence:CCGGTGCTGCCTCGCCTCTAGATATCTCGAGATATCTAGAGGCGAGGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014291.3-1247s21c1
Sequence:CCGGTGCATAGCGAGGAAGACATTGCTCGAGCAATGTCTTCCTCGCTATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014291.3-531s21c1
Sequence:CCGGGCTGAACCATGCCTCCATCATCTCGAGATGATGGAGGCATGGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks