EMAIL THIS PAGE TO A FRIEND

GCC2

GRIP and coiled-coil domain containing 2

168 Gene Product Result for
Synonyms: GCC185 RANBP2L4 REN53
UniProtKB ID: Q8IWJ2, A6H8X8, O15045, Q4ZG46, Q8TDH3, Q9H2G8
Gene ID:
Human(9648) Summary: The protein encoded by this gene is a peripheral membrane protein localized to the trans-Golgi network. It is sensitive to brefeldin A. This encoded protein contains a GRIP domain which is thought to be used in targeting. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Mouse(70297) GRIP and coiled-coil domain containing 2
Rat(309798) GRIP and coiled-coil domain containing 2
Zebrafish(100329757) GRIP and coiled-coil domain containing 2
cow(539484) GRIP and coiled-coil domain containing 2
Horse(100061081) GRIP and coiled-coil domain containing 2
domestic cat(101094919) GRIP and coiled-coil domain containing 2
dog(474541) GRIP and coiled-coil domain containing 2
chicken(428014) GRIP and coiled-coil domain containing 2
domestic guinea pig(100730195) GRIP and coiled-coil domain containing 2
naked mole-rat(101725764) GRIP and coiled-coil domain containing 2
sheep(101108824) GRIP and coiled-coil domain containing 2
Domestic Rabbit(100358853) GRIP and coiled-coil domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014635 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU148351 MISSION® esiRNA esiRNA targeting mouse Gcc2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014635 Rosetta Predictions human pricing
NM_181453 Rosetta Predictions human pricing
NM_001107633 Rosetta Predictions rat pricing
NM_027375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188661 predicted 3220
2 SASI_Hs02_00345941 predicted 1713
3 SASI_Hs01_00188664 predicted 2451
4 SASI_Hs01_00188665 predicted 779
5 SASI_Hs01_00188666 predicted 1015
6 SASI_Hs01_00188667 predicted 4340
7 SASI_Hs02_00345942 predicted 940
8 SASI_Hs02_00345943 predicted 4046
9 SASI_Hs01_00188670 predicted 412
10 SASI_Hs02_00345944 predicted 3429
11 SASI_Hs01_00188662 predicted 4626
12 SASI_Hs01_00188663 predicted 2526
13 SASI_Hs01_00188668 predicted 4030
14 SASI_Hs01_00188669 predicted 3609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230098 predicted 3309
2 SASI_Hs02_00370060 predicted 1801
3 SASI_Hs01_00230101 predicted 2541
4 SASI_Hs01_00230102 predicted 859
5 SASI_Hs01_00230103 predicted 1094
6 SASI_Hs01_00230104 predicted 4416
7 SASI_Hs02_00370061 predicted 4131
8 SASI_Hs01_00230107 predicted 500
9 SASI_Hs02_00370062 predicted 3512
10 SASI_Hs02_00370063 predicted 1792
11 SASI_Hs01_00230099 predicted 4708
12 SASI_Hs01_00230100 predicted 2614
13 SASI_Hs01_00230105 predicted 4122
14 SASI_Hs01_00230106 predicted 3687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230755 predicted 3169
2 SASI_Rn02_00230756 predicted 1961
3 SASI_Rn02_00230757 predicted 1042
4 SASI_Rn02_00230758 predicted 3040
5 SASI_Rn02_00230759 predicted 3268
6 SASI_Rn02_00230760 predicted 3754
7 SASI_Rn02_00230761 predicted 3452
8 SASI_Rn02_00230762 predicted 1107
9 SASI_Rn02_00230763 predicted 2967
10 SASI_Rn02_00230764 predicted 2320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332069 predicted 3187
2 SASI_Mm01_00138310 predicted 3250
3 SASI_Mm01_00138311 predicted 1030
4 SASI_Mm01_00138314 predicted 3607
5 SASI_Mm02_00332070 predicted 1339
6 SASI_Mm01_00138315 predicted 2944
7 SASI_Mm02_00332071 predicted 228
8 SASI_Mm01_00138318 predicted 4289
9 SASI_Mm02_00332072 predicted 4673
10 SASI_Mm02_00332073 predicted 1950
11 SASI_Mm01_00138309 predicted 4781
12 SASI_Mm01_00138312 predicted 2295
13 SASI_Mm01_00138313 predicted 4841
14 SASI_Mm01_00138316 predicted 1097
15 SASI_Mm01_00138317 predicted 2777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027375
VALIDATED
GCC2 MISSION shRNA Bacterial Glycerol Stock
GRIP and coiled-coil domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-5487s1c1
Sequence:CCGGGCCGTGTTTATTAAAGGATTACTCGAGTAATCCTTTAATAAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-3612s1c1
Sequence:CCGGCCCTACAAGAAGAAATAACTTCTCGAGAAGTTATTTCTTCTTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-4786s1c1
Sequence:CCGGCGCTATCCTTATGGAGCAAATCTCGAGATTTGCTCCATAAGGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-3192s1c1
Sequence:CCGGGCCAGTATGAAAGACTAACTTCTCGAGAAGTTAGTCTTTCATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-1002s1c1
Sequence:CCGGCGGAACAAACAGTATGTGATACTCGAGTATCACATACTGTTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027375
VALIDATED
GCC2 MISSION shRNA shRNA Plasmid DNA
GRIP and coiled-coil domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-5487s1c1
Sequence:CCGGGCCGTGTTTATTAAAGGATTACTCGAGTAATCCTTTAATAAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-3612s1c1
Sequence:CCGGCCCTACAAGAAGAAATAACTTCTCGAGAAGTTATTTCTTCTTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-4786s1c1
Sequence:CCGGCGCTATCCTTATGGAGCAAATCTCGAGATTTGCTCCATAAGGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-3192s1c1
Sequence:CCGGGCCAGTATGAAAGACTAACTTCTCGAGAAGTTAGTCTTTCATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-1002s1c1
Sequence:CCGGCGGAACAAACAGTATGTGATACTCGAGTATCACATACTGTTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027375
VALIDATED
GCC2 MISSION shRNA Lentiviral Transduction Particles
GRIP and coiled-coil domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-5487s1c1
Sequence:CCGGGCCGTGTTTATTAAAGGATTACTCGAGTAATCCTTTAATAAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-3612s1c1
Sequence:CCGGCCCTACAAGAAGAAATAACTTCTCGAGAAGTTATTTCTTCTTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-4786s1c1
Sequence:CCGGCGCTATCCTTATGGAGCAAATCTCGAGATTTGCTCCATAAGGATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-3192s1c1
Sequence:CCGGGCCAGTATGAAAGACTAACTTCTCGAGAAGTTAGTCTTTCATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027375.2-1002s1c1
Sequence:CCGGCGGAACAAACAGTATGTGATACTCGAGTATCACATACTGTTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014635
GCC2 MISSION shRNA Bacterial Glycerol Stock
GRIP and coiled-coil domain containing 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000150103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014635.3-5416s1c1
Sequence:CCGGCCAACTGGAATTTAGGCTTTACTCGAGTAAAGCCTAAATTCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014635.3-2773s1c1
Sequence:CCGGGAGAGCAGAGTTGATACTATTCTCGAGAATAGTATCAACTCTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014635.3-3436s1c1
Sequence:CCGGGCAAGAATTAGAGCTGGTTAACTCGAGTTAACCAGCTCTAATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014635.3-6536s1c1
Sequence:CCGGGCTGACATGAAGAGTTTAGTTCTCGAGAACTAAACTCTTCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014635
GCC2 MISSION shRNA shRNA Plasmid DNA
GRIP and coiled-coil domain containing 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000150103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014635.3-5416s1c1
Sequence:CCGGCCAACTGGAATTTAGGCTTTACTCGAGTAAAGCCTAAATTCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014635.3-2773s1c1
Sequence:CCGGGAGAGCAGAGTTGATACTATTCTCGAGAATAGTATCAACTCTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014635.3-3436s1c1
Sequence:CCGGGCAAGAATTAGAGCTGGTTAACTCGAGTTAACCAGCTCTAATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014635.3-6536s1c1
Sequence:CCGGGCTGACATGAAGAGTTTAGTTCTCGAGAACTAAACTCTTCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014635
GCC2 MISSION shRNA Lentiviral Transduction Particles
GRIP and coiled-coil domain containing 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000150103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014635.3-5416s1c1
Sequence:CCGGCCAACTGGAATTTAGGCTTTACTCGAGTAAAGCCTAAATTCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014635.3-2773s1c1
Sequence:CCGGGAGAGCAGAGTTGATACTATTCTCGAGAATAGTATCAACTCTGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014635.3-3436s1c1
Sequence:CCGGGCAAGAATTAGAGCTGGTTAACTCGAGTTAACCAGCTCTAATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014635.3-6536s1c1
Sequence:CCGGGCTGACATGAAGAGTTTAGTTCTCGAGAACTAAACTCTTCATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks