EMAIL THIS PAGE TO A FRIEND

GCDH

glutaryl-CoA dehydrogenase

81 Gene Product Result for
Synonyms: ACAD5 GCD
UniProtKB ID: Q92947, A8K2Z2, O14719
Gene ID:
Human(2639) Summary: The protein encoded by this gene belongs to the acyl-CoA dehydrogenase family. It catalyzes the oxidative decarboxylation of glutaryl-CoA to crotonyl-CoA and CO(2) in the degradative pathway of L-lysine, L-hydroxylysine, and L-tryptophan metabolism. It uses electron transfer flavoprotein as its electron acceptor. The enzyme exists in the mitochondrial matrix as a homotetramer of 45-kD subunits. Mutations in this gene result in the metabolic disorder glutaric aciduria type 1, which is also known as glutaric acidemia type I. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 12. [provided by RefSeq, Mar 2013]
Mouse(270076) glutaryl-Coenzyme A dehydrogenase
Rat(364975) glutaryl-CoA dehydrogenase
Zebrafish(393860) glutaryl-Coenzyme A dehydrogenase
cow(506310) glutaryl-CoA dehydrogenase
Horse(100063310) glutaryl-CoA dehydrogenase
domestic cat(101086880) glutaryl-CoA dehydrogenase
chicken(771098) glutaryl-CoA dehydrogenase
dog(476696) glutaryl-CoA dehydrogenase
sheep(101122190) glutaryl-CoA dehydrogenase
Domestic Rabbit(100343376) glutaryl-CoA dehydrogenase
naked mole-rat(101718348) glutaryl-CoA dehydrogenase
domestic guinea pig(100714939) glutaryl-CoA dehydrogenase
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101116 Anti-GCDH (191-205) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1101115 Anti-GCDH (41-55) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1405857 Anti-GCDH antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV43559 Anti-GCDH antibody produced in rabbit IgG fraction of antiserum human, rat, mouse, zebrafish, rabbit, horse, canine
immunohistochemistry, western blot pricing
SAB2100905 Anti-GCDH antibody produced in rabbit affinity isolated antibody rat, guinea pig, human, rabbit, mouse, horse
western blot pricing
HPA048492 Anti-GCDH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA043252 Anti-GCDH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106636 Anti-GCDH antibody produced in rabbit affinity isolated antibody guinea pig, rat, horse, human, rabbit
ELISA, western blot pricing
SAB1410514 Anti-GCDH antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013976 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013976 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013976 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008097 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008097 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008097 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000159 Rosetta Predictions human pricing
NM_013976 Rosetta Predictions human pricing
NM_001108896 Rosetta Predictions rat pricing
NM_001044744 Rosetta Predictions mouse pricing
NM_008097 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246318 predicted 697
2 SASI_Hs01_00246319 predicted 1079
3 SASI_Hs01_00246320 predicted 660
4 SASI_Hs01_00246321 predicted 513
5 SASI_Hs01_00246324 predicted 251
6 SASI_Hs01_00246325 predicted 719
7 SASI_Hs02_00301977 predicted 849
8 SASI_Hs01_00246326 predicted 671
9 SASI_Hs01_00246327 predicted 297
10 SASI_Hs02_00301978 predicted 293
11 SASI_Hs01_00246322 predicted 322
12 SASI_Hs01_00246323 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011488 predicted 699
2 SASI_Hs01_00011489 predicted 1085
3 SASI_Hs01_00011490 predicted 653
4 SASI_Hs01_00011491 predicted 506
5 SASI_Hs01_00011493 predicted 1030
6 SASI_Hs01_00011495 predicted 717
7 SASI_Hs02_00344923 predicted 850
8 SASI_Hs01_00011496 predicted 669
9 SASI_Hs01_00011497 predicted 300
10 SASI_Hs02_00344924 predicted 291
11 SASI_Hs01_00011492 predicted 322
12 SASI_Hs01_00011494 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243155 predicted 1385
2 SASI_Rn02_00243156 predicted 1476
3 SASI_Rn02_00243157 predicted 322
4 SASI_Rn02_00243158 predicted 739
5 SASI_Rn02_00243159 predicted 330
6 SASI_Rn02_00243160 predicted 1388
7 SASI_Rn02_00243161 predicted 256
8 SASI_Rn02_00243162 predicted 1556
9 SASI_Rn02_00243163 predicted 1567
10 SASI_Rn02_00243164 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291414 predicted 1518
2 SASI_Mm02_00291415 predicted 455
3 SASI_Mm02_00291416 predicted 1264
4 SASI_Mm02_00291417 predicted 1418
5 SASI_Mm02_00291418 predicted 1219
6 SASI_Mm02_00291419 predicted 1533
7 SASI_Mm02_00291420 predicted 790
8 SASI_Mm02_00291421 predicted 1433
9 SASI_Mm02_00291422 predicted 1447
10 SASI_Mm02_00291423 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065970 predicted 1582
2 SASI_Mm01_00065973 predicted 520
3 SASI_Mm01_00065972 predicted 1328
4 SASI_Mm01_00065976 predicted 1473
5 SASI_Mm01_00065977 predicted 1272
6 SASI_Mm02_00313122 predicted 1595
7 SASI_Mm01_00065975 predicted 846
8 SASI_Mm01_00065978 predicted 1494
9 SASI_Mm02_00313123 predicted 1511
10 SASI_Mm02_00313124 predicted 1490
11 SASI_Mm01_00065971 predicted 738
12 SASI_Mm01_00065974 predicted 827
13 SASI_Mm01_00065979 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013976
VALIDATED
GCDH MISSION shRNA Bacterial Glycerol Stock
glutaryl-CoA dehydrogenase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013976.1-475s1c1
Sequence:CCGGCTCGTCATGCACCCTATCTATCTCGAGATAGATAGGGTGCATGACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013976.1-1045s1c1
Sequence:CCGGGCAGACATGCTCACTGAGATTCTCGAGAATCTCAGTGAGCATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013976.1-1281s1c1
Sequence:CCGGCGTTCAGATGTGTTCCTTAAACTCGAGTTTAAGGAACACATCTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013976.1-1128s1c1
Sequence:CCGGCGAGATGGTTTCTCTGCTGAACTCGAGTTCAGCAGAGAAACCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013976.1-621s1c1
Sequence:CCGGCCACTACAACTCATCCAACAACTCGAGTTGTTGGATGAGTTGTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-1391s21c1
Sequence:CCGGGATGAGAGCAGACTCCATTTACTCGAGTAAATGGAGTCTGCTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-1252s21c1
Sequence:CCGGATGGGATTTCTGACGAGTATCCTCGAGGATACTCGTCAGAAATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-516s21c1
Sequence:CCGGCTCGTCATGCACCCTATCTATCTCGAGATAGATAGGGTGCATGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-1086s21c1
Sequence:CCGGGCAGACATGCTCACTGAGATTCTCGAGAATCTCAGTGAGCATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-1169s21c1
Sequence:CCGGCGAGATGGTTTCTCTGCTGAACTCGAGTTCAGCAGAGAAACCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013976
VALIDATED
GCDH MISSION shRNA shRNA Plasmid DNA
glutaryl-CoA dehydrogenase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013976.1-475s1c1
Sequence:CCGGCTCGTCATGCACCCTATCTATCTCGAGATAGATAGGGTGCATGACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013976.1-1045s1c1
Sequence:CCGGGCAGACATGCTCACTGAGATTCTCGAGAATCTCAGTGAGCATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013976.1-1281s1c1
Sequence:CCGGCGTTCAGATGTGTTCCTTAAACTCGAGTTTAAGGAACACATCTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013976.1-1128s1c1
Sequence:CCGGCGAGATGGTTTCTCTGCTGAACTCGAGTTCAGCAGAGAAACCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013976.1-621s1c1
Sequence:CCGGCCACTACAACTCATCCAACAACTCGAGTTGTTGGATGAGTTGTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-1391s21c1
Sequence:CCGGGATGAGAGCAGACTCCATTTACTCGAGTAAATGGAGTCTGCTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-1252s21c1
Sequence:CCGGATGGGATTTCTGACGAGTATCCTCGAGGATACTCGTCAGAAATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-516s21c1
Sequence:CCGGCTCGTCATGCACCCTATCTATCTCGAGATAGATAGGGTGCATGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-1086s21c1
Sequence:CCGGGCAGACATGCTCACTGAGATTCTCGAGAATCTCAGTGAGCATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-1169s21c1
Sequence:CCGGCGAGATGGTTTCTCTGCTGAACTCGAGTTCAGCAGAGAAACCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013976
VALIDATED
GCDH MISSION shRNA Lentiviral Transduction Particles
glutaryl-CoA dehydrogenase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013976.1-475s1c1
Sequence:CCGGCTCGTCATGCACCCTATCTATCTCGAGATAGATAGGGTGCATGACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013976.1-1045s1c1
Sequence:CCGGGCAGACATGCTCACTGAGATTCTCGAGAATCTCAGTGAGCATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013976.1-1281s1c1
Sequence:CCGGCGTTCAGATGTGTTCCTTAAACTCGAGTTTAAGGAACACATCTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013976.1-1128s1c1
Sequence:CCGGCGAGATGGTTTCTCTGCTGAACTCGAGTTCAGCAGAGAAACCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013976.1-621s1c1
Sequence:CCGGCCACTACAACTCATCCAACAACTCGAGTTGTTGGATGAGTTGTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-1391s21c1
Sequence:CCGGGATGAGAGCAGACTCCATTTACTCGAGTAAATGGAGTCTGCTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-1252s21c1
Sequence:CCGGATGGGATTTCTGACGAGTATCCTCGAGGATACTCGTCAGAAATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-516s21c1
Sequence:CCGGCTCGTCATGCACCCTATCTATCTCGAGATAGATAGGGTGCATGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-1086s21c1
Sequence:CCGGGCAGACATGCTCACTGAGATTCTCGAGAATCTCAGTGAGCATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_013976.2-1169s21c1
Sequence:CCGGCGAGATGGTTTCTCTGCTGAACTCGAGTTCAGCAGAGAAACCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008097
GCDH MISSION shRNA Bacterial Glycerol Stock
glutaryl-CoA dehydrogenase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-727s1c1
Sequence:CCGGCGGTGTGAGGATAACTGTATTCTCGAGAATACAGTTATCCTCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-1158s1c1
Sequence:CCGGGAAGAGAAACAACTGTGGAAACTCGAGTTTCCACAGTTGTTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-1270s1c1
Sequence:CCGGGAGGCAGTGAACACTTATGAACTCGAGTTCATAAGTGTTCACTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-865s1c1
Sequence:CCGGGAGGAGAATGTGCTGCCTAATCTCGAGATTAGGCAGCACATTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-277s1c1
Sequence:CCGGGAGCGGCTTATGTCTCAAATTCTCGAGAATTTGAGACATAAGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008097.2-946s21c1
Sequence:CCGGCGGTGTGAGGATAACTGTATTCTCGAGAATACAGTTATCCTCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008097.2-1084s21c1
Sequence:CCGGGAGGAGAATGTGCTGCCTAATCTCGAGATTAGGCAGCACATTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008097.2-1377s21c1
Sequence:CCGGGAAGAGAAACAACTGTGGAAACTCGAGTTTCCACAGTTGTTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008097.2-1489s21c1
Sequence:CCGGGAGGCAGTGAACACTTATGAACTCGAGTTCATAAGTGTTCACTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008097
GCDH MISSION shRNA shRNA Plasmid DNA
glutaryl-CoA dehydrogenase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-727s1c1
Sequence:CCGGCGGTGTGAGGATAACTGTATTCTCGAGAATACAGTTATCCTCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-1158s1c1
Sequence:CCGGGAAGAGAAACAACTGTGGAAACTCGAGTTTCCACAGTTGTTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-1270s1c1
Sequence:CCGGGAGGCAGTGAACACTTATGAACTCGAGTTCATAAGTGTTCACTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-865s1c1
Sequence:CCGGGAGGAGAATGTGCTGCCTAATCTCGAGATTAGGCAGCACATTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-277s1c1
Sequence:CCGGGAGCGGCTTATGTCTCAAATTCTCGAGAATTTGAGACATAAGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008097.2-946s21c1
Sequence:CCGGCGGTGTGAGGATAACTGTATTCTCGAGAATACAGTTATCCTCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008097.2-1084s21c1
Sequence:CCGGGAGGAGAATGTGCTGCCTAATCTCGAGATTAGGCAGCACATTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008097.2-1377s21c1
Sequence:CCGGGAAGAGAAACAACTGTGGAAACTCGAGTTTCCACAGTTGTTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008097.2-1489s21c1
Sequence:CCGGGAGGCAGTGAACACTTATGAACTCGAGTTCATAAGTGTTCACTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008097
GCDH MISSION shRNA Lentiviral Transduction Particles
glutaryl-CoA dehydrogenase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-727s1c1
Sequence:CCGGCGGTGTGAGGATAACTGTATTCTCGAGAATACAGTTATCCTCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-1158s1c1
Sequence:CCGGGAAGAGAAACAACTGTGGAAACTCGAGTTTCCACAGTTGTTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-1270s1c1
Sequence:CCGGGAGGCAGTGAACACTTATGAACTCGAGTTCATAAGTGTTCACTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-865s1c1
Sequence:CCGGGAGGAGAATGTGCTGCCTAATCTCGAGATTAGGCAGCACATTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008097.1-277s1c1
Sequence:CCGGGAGCGGCTTATGTCTCAAATTCTCGAGAATTTGAGACATAAGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008097.2-946s21c1
Sequence:CCGGCGGTGTGAGGATAACTGTATTCTCGAGAATACAGTTATCCTCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008097.2-1084s21c1
Sequence:CCGGGAGGAGAATGTGCTGCCTAATCTCGAGATTAGGCAGCACATTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008097.2-1377s21c1
Sequence:CCGGGAAGAGAAACAACTGTGGAAACTCGAGTTTCCACAGTTGTTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008097.2-1489s21c1
Sequence:CCGGGAGGCAGTGAACACTTATGAACTCGAGTTCATAAGTGTTCACTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks