EMAIL THIS PAGE TO A FRIEND

GCFC2

GC-rich sequence DNA-binding factor 2

56 Gene Product Result for
Synonyms: C2orf3 DNABF GCF TCF9
UniProtKB ID: P16383, O95032, Q53TY0, Q6P2F2
Gene ID:
Human(6936) Summary: The first mRNA transcript isolated for this gene was part of an artificial chimera derived from two distinct gene transcripts and a primer used in the cloning process (see Genbank accession M29204). A positively charged amino terminus present only in the chimera was determined to bind GC-rich DNA, thus mistakenly thought to identify a transcription factor gene. [provided by RefSeq, Jul 2008]
Mouse(330361) GC-rich sequence DNA binding factor 2
Rat(312474) GC-rich sequence DNA-binding factor 2
sheep(101117834) GC-rich sequence DNA-binding factor 2
domestic guinea pig(100734711) GC-rich sequence DNA-binding factor 2
naked mole-rat(101718296) GC-rich sequence DNA-binding factor 2
Zebrafish(559280) GC-rich sequence DNA-binding factor 2
cow(521363) GC-rich sequence DNA-binding factor 2
domestic cat(101080706) GC-rich sequence DNA-binding factor 2
dog(483094) GC-rich sequence DNA-binding factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003203 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003203 Rosetta Predictions human pricing
NM_001134554 Rosetta Predictions rat pricing
NM_177884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335242 predicted 1955
2 SASI_Hs01_00061190 predicted 1263
3 SASI_Hs01_00061191 predicted 2649
4 SASI_Hs01_00061192 predicted 2148
5 SASI_Hs01_00061193 predicted 912
6 SASI_Hs01_00061194 predicted 2065
7 SASI_Hs02_00335243 predicted 1868
8 SASI_Hs01_00061196 predicted 668
9 SASI_Hs01_00061197 predicted 2618
10 SASI_Hs01_00061198 predicted 2531
11 SASI_Hs01_00061195 predicted 2787
12 SASI_Hs01_00061199 predicted 2499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257029 predicted 884
2 SASI_Rn02_00257030 predicted 2046
3 SASI_Rn02_00257031 predicted 1886
4 SASI_Rn02_00257032 predicted 1810
5 SASI_Rn02_00257033 predicted 611
6 SASI_Rn02_00257034 predicted 1343
7 SASI_Rn02_00257035 predicted 665
8 SASI_Rn02_00257036 predicted 741
9 SASI_Rn02_00257037 predicted 2103
10 SASI_Rn02_00257038 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194819 predicted 811
2 SASI_Mm01_00194820 predicted 766
3 SASI_Mm01_00194821 predicted 1037
4 SASI_Mm01_00194823 predicted 2443
5 SASI_Mm01_00194824 predicted 313
6 SASI_Mm01_00194825 predicted 1530
7 SASI_Mm01_00194826 predicted 1027
8 SASI_Mm01_00194827 predicted 1995
9 SASI_Mm02_00348370 predicted 369
10 SASI_Mm01_00194828 predicted 464
11 SASI_Mm01_00194822 predicted 1510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003203
VALIDATED
GCFC2 MISSION shRNA Bacterial Glycerol Stock
GC-rich sequence DNA-binding factor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003203.4-2889s21c1
Sequence:CCGGCTCAGTTGGAGTGAATTATTTCTCGAGAAATAATTCACTCCAACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003203.4-1068s21c1
Sequence:CCGGCATCAAATCAAGCTCTAAATTCTCGAGAATTTAGAGCTTGATTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003203.4-2933s21c1
Sequence:CCGGATGTGCCGATTGTCAAATTATCTCGAGATAATTTGACAATCGGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003203.4-2791s21c1
Sequence:CCGGTTAAGTGAGCATGCTACTAAGCTCGAGCTTAGTAGCATGCTCACTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003203.4-2082s21c1
Sequence:CCGGTAAAGCTCTTCCGCAATATTCCTCGAGGAATATTGCGGAAGAGCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003203.3-1120s1c1
Sequence:CCGGCCATTTCATTTCCGCCAGTAACTCGAGTTACTGGCGGAAATGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003203.3-2022s1c1
Sequence:CCGGCGACTTACAGACTTTGTAGAACTCGAGTTCTACAAAGTCTGTAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003203.3-2369s1c1
Sequence:CCGGGCTGCTAAATCGTTACCTTATCTCGAGATAAGGTAACGATTTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003203.3-909s1c1
Sequence:CCGGCCATTTACTCTAAGACCTCAACTCGAGTTGAGGTCTTAGAGTAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003203.3-2779s1c1
Sequence:CCGGCCTGTAATAGAAGGTAGGATTCTCGAGAATCCTACCTTCTATTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003203
VALIDATED
GCFC2 MISSION shRNA shRNA Plasmid DNA
GC-rich sequence DNA-binding factor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003203.4-2889s21c1
Sequence:CCGGCTCAGTTGGAGTGAATTATTTCTCGAGAAATAATTCACTCCAACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003203.4-1068s21c1
Sequence:CCGGCATCAAATCAAGCTCTAAATTCTCGAGAATTTAGAGCTTGATTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003203.4-2933s21c1
Sequence:CCGGATGTGCCGATTGTCAAATTATCTCGAGATAATTTGACAATCGGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003203.4-2791s21c1
Sequence:CCGGTTAAGTGAGCATGCTACTAAGCTCGAGCTTAGTAGCATGCTCACTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003203.4-2082s21c1
Sequence:CCGGTAAAGCTCTTCCGCAATATTCCTCGAGGAATATTGCGGAAGAGCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003203.3-1120s1c1
Sequence:CCGGCCATTTCATTTCCGCCAGTAACTCGAGTTACTGGCGGAAATGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003203.3-2022s1c1
Sequence:CCGGCGACTTACAGACTTTGTAGAACTCGAGTTCTACAAAGTCTGTAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003203.3-2369s1c1
Sequence:CCGGGCTGCTAAATCGTTACCTTATCTCGAGATAAGGTAACGATTTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003203.3-909s1c1
Sequence:CCGGCCATTTACTCTAAGACCTCAACTCGAGTTGAGGTCTTAGAGTAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003203.3-2779s1c1
Sequence:CCGGCCTGTAATAGAAGGTAGGATTCTCGAGAATCCTACCTTCTATTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003203
VALIDATED
GCFC2 MISSION shRNA Lentiviral Transduction Particles
GC-rich sequence DNA-binding factor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003203.4-2889s21c1
Sequence:CCGGCTCAGTTGGAGTGAATTATTTCTCGAGAAATAATTCACTCCAACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003203.4-1068s21c1
Sequence:CCGGCATCAAATCAAGCTCTAAATTCTCGAGAATTTAGAGCTTGATTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003203.4-2933s21c1
Sequence:CCGGATGTGCCGATTGTCAAATTATCTCGAGATAATTTGACAATCGGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003203.4-2791s21c1
Sequence:CCGGTTAAGTGAGCATGCTACTAAGCTCGAGCTTAGTAGCATGCTCACTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003203.4-2082s21c1
Sequence:CCGGTAAAGCTCTTCCGCAATATTCCTCGAGGAATATTGCGGAAGAGCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003203.3-1120s1c1
Sequence:CCGGCCATTTCATTTCCGCCAGTAACTCGAGTTACTGGCGGAAATGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003203.3-2022s1c1
Sequence:CCGGCGACTTACAGACTTTGTAGAACTCGAGTTCTACAAAGTCTGTAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003203.3-2369s1c1
Sequence:CCGGGCTGCTAAATCGTTACCTTATCTCGAGATAAGGTAACGATTTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003203.3-909s1c1
Sequence:CCGGCCATTTACTCTAAGACCTCAACTCGAGTTGAGGTCTTAGAGTAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003203.3-2779s1c1
Sequence:CCGGCCTGTAATAGAAGGTAGGATTCTCGAGAATCCTACCTTCTATTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177884
VALIDATED
GCFC2 MISSION shRNA Bacterial Glycerol Stock
GC-rich sequence DNA-binding factor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177884.3-742s1c1
Sequence:CCGGCCCACAGCAGTAAGTCTCAAACTCGAGTTTGAGACTTACTGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177884.3-2030s1c1
Sequence:CCGGGCTGCTGAATCGCTACCTTATCTCGAGATAAGGTAGCGATTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177884.3-2658s1c1
Sequence:CCGGCGGTCTCATTCTGAAGTGTAACTCGAGTTACACTTCAGAATGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177884.3-1950s1c1
Sequence:CCGGGCTCTAAAGCTCTTCCGAAATCTCGAGATTTCGGAAGAGCTTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177884.3-1536s1c1
Sequence:CCGGCCTCTTAAGATGGACTCCATACTCGAGTATGGAGTCCATCTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177884
VALIDATED
GCFC2 MISSION shRNA shRNA Plasmid DNA
GC-rich sequence DNA-binding factor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177884.3-742s1c1
Sequence:CCGGCCCACAGCAGTAAGTCTCAAACTCGAGTTTGAGACTTACTGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177884.3-2030s1c1
Sequence:CCGGGCTGCTGAATCGCTACCTTATCTCGAGATAAGGTAGCGATTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177884.3-2658s1c1
Sequence:CCGGCGGTCTCATTCTGAAGTGTAACTCGAGTTACACTTCAGAATGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177884.3-1950s1c1
Sequence:CCGGGCTCTAAAGCTCTTCCGAAATCTCGAGATTTCGGAAGAGCTTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177884.3-1536s1c1
Sequence:CCGGCCTCTTAAGATGGACTCCATACTCGAGTATGGAGTCCATCTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177884
VALIDATED
GCFC2 MISSION shRNA Lentiviral Transduction Particles
GC-rich sequence DNA-binding factor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177884.3-742s1c1
Sequence:CCGGCCCACAGCAGTAAGTCTCAAACTCGAGTTTGAGACTTACTGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177884.3-2030s1c1
Sequence:CCGGGCTGCTGAATCGCTACCTTATCTCGAGATAAGGTAGCGATTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177884.3-2658s1c1
Sequence:CCGGCGGTCTCATTCTGAAGTGTAACTCGAGTTACACTTCAGAATGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177884.3-1950s1c1
Sequence:CCGGGCTCTAAAGCTCTTCCGAAATCTCGAGATTTCGGAAGAGCTTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177884.3-1536s1c1
Sequence:CCGGCCTCTTAAGATGGACTCCATACTCGAGTATGGAGTCCATCTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks