EMAIL THIS PAGE TO A FRIEND

GCG

glucagon

125 Gene Product Result for
Synonyms: GLP1 GLP2 GRPP
UniProtKB ID: P01275, A6NN65, Q53TP6
Gene ID:
Human(2641) Summary: The protein encoded by this gene is actually a preproprotein that is cleaved into four distinct mature peptides. One of these, glucagon, is a pancreatic hormone that counteracts the glucose-lowering action of insulin by stimulating glycogenolysis and gluconeogenesis. Glucagon is a ligand for a specific G-protein linked receptor whose signalling pathway controls cell proliferation. Two of the other peptides are secreted from gut endocrine cells and promote nutrient absorption through distinct mechanisms. Finally, the fourth peptide is similar to glicentin, an active enteroglucagon. [provided by RefSeq, Jul 2008]
Mouse(14526) glucagon
Rat(24952) glucagon
chicken(396196) glucagon
cow(280802) glucagon
dog(403571) glucagon
sheep(443179) glucagon
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV42010 Anti-GCG antibody produced in rabbit IgG fraction of antiserum canine, human, guinea pig, mouse, rabbit, rat, horse, sheep, rabbit
western blot pricing
HPA036760 Anti-GCG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA036761 Anti-GCG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2104861 Anti-GCG antibody produced in rabbit affinity isolated antibody sheep, rat, horse, rabbit, human, mouse, guinea pig
western blot pricing
SAB1410515 Anti-GCG antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4200642 Anti-GLP−1 (C−terminal) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4501137 Anti-Glucagon antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB1306596 ANTI-GLUCAGON(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
WH0002641M1 Monoclonal Anti-GCG antibody produced in mouse clone 2D3-2B11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403855 Monoclonal Anti-GCG antibody produced in mouse clone 1E2-E6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
G2654 Monoclonal Anti-Glucagon antibody produced in mouse clone K79bB10, ascites fluid rat, pig, guinea pig, feline, mouse, human, canine, rabbit
dot blot, immunohistochemistry, radioimmunoassay pricing
SAB1305509 MONOCLONAL ANTI-GLUCAGON antibody produced in mouse clone 329CT36.10.10, IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1305508 MONOCLONAL ANTI-GLUCAGON antibody produced in mouse clone 329CT36.10.10, crude ascites, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008100 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008100 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008100 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002054 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005721 MISSION® esiRNA esiRNA targeting human GCG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002054 Rosetta Predictions human pricing
NM_012707 Rosetta Predictions rat pricing
NM_008100 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068245 predicted 364
2 SASI_Hs01_00068246 predicted 405
3 SASI_Hs01_00068247 predicted 557
4 SASI_Hs01_00068248 predicted 521
5 SASI_Hs01_00068249 predicted 635
6 SASI_Hs02_00333097 predicted 904
7 SASI_Hs01_00068251 predicted 494
8 SASI_Hs01_00068252 predicted 706
9 SASI_Hs01_00068253 predicted 550
10 SASI_Hs01_00068254 predicted 416
11 SASI_Hs01_00068250 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057269 predicted 265
2 SASI_Rn01_00057270 predicted 200
3 SASI_Rn02_00260032 predicted 307
4 SASI_Rn01_00057271 predicted 250
5 SASI_Rn01_00057272 predicted 268
6 SASI_Rn01_00057273 predicted 247
7 SASI_Rn01_00057274 predicted 247
8 SASI_Rn02_00260033 predicted 303
9 SASI_Rn01_00057275 predicted 298
10 SASI_Rn01_00057276 predicted 302
11 SASI_Rn01_00057267 predicted 305
12 SASI_Rn01_00057268 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313128 predicted 641
2 SASI_Mm01_00083386 predicted 623
3 SASI_Mm02_00313129 predicted 554
4 SASI_Mm02_00313130 predicted 629
5 SASI_Mm02_00313131 predicted 534
6 SASI_Mm02_00313132 predicted 345
7 SASI_Mm01_00083388 predicted 386
8 SASI_Mm02_00313133 predicted 358
9 SASI_Mm02_00313134 predicted 565
10 SASI_Mm02_00313135 predicted 565
11 SASI_Mm01_00083385 predicted 640
12 SASI_Mm01_00083387 predicted 277
13 SASI_Mm01_00083389 predicted 221
14 SASI_Mm01_00083390 predicted 263
15 SASI_Mm01_00083391 predicted 635
16 SASI_Mm01_00083392 predicted 332
17 SASI_Mm01_00083393 predicted 553
18 SASI_Mm01_00083394 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008100
GCG MISSION shRNA Bacterial Glycerol Stock
glucagon
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008100.2-766s1c1
Sequence:CCGGGCATTGTGTAACCCAACGATTCTCGAGAATCGTTGGGTTACACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008100.2-440s1c1
Sequence:CCGGCCAGGCAGCAAAGGAATTCATCTCGAGATGAATTCCTTTGCTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008100.2-608s1c1
Sequence:CCGGCTGGCTGATTCAAACCAAGATCTCGAGATCTTGGTTTGAATCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008100.2-326s1c1
Sequence:CCGGGCAGTGGTTGATGAACACCAACTCGAGTTGGTGTTCATCAACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008100.2-167s1c1
Sequence:CCGGCCTTCAAGACACAGAGGAGAACTCGAGTTCTCCTCTGTGTCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008100
GCG MISSION shRNA shRNA Plasmid DNA
glucagon
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008100.2-766s1c1
Sequence:CCGGGCATTGTGTAACCCAACGATTCTCGAGAATCGTTGGGTTACACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008100.2-440s1c1
Sequence:CCGGCCAGGCAGCAAAGGAATTCATCTCGAGATGAATTCCTTTGCTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008100.2-608s1c1
Sequence:CCGGCTGGCTGATTCAAACCAAGATCTCGAGATCTTGGTTTGAATCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008100.2-326s1c1
Sequence:CCGGGCAGTGGTTGATGAACACCAACTCGAGTTGGTGTTCATCAACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008100.2-167s1c1
Sequence:CCGGCCTTCAAGACACAGAGGAGAACTCGAGTTCTCCTCTGTGTCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008100
GCG MISSION shRNA Lentiviral Transduction Particles
glucagon
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008100.2-766s1c1
Sequence:CCGGGCATTGTGTAACCCAACGATTCTCGAGAATCGTTGGGTTACACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008100.2-440s1c1
Sequence:CCGGCCAGGCAGCAAAGGAATTCATCTCGAGATGAATTCCTTTGCTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008100.2-608s1c1
Sequence:CCGGCTGGCTGATTCAAACCAAGATCTCGAGATCTTGGTTTGAATCAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008100.2-326s1c1
Sequence:CCGGGCAGTGGTTGATGAACACCAACTCGAGTTGGTGTTCATCAACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008100.2-167s1c1
Sequence:CCGGCCTTCAAGACACAGAGGAGAACTCGAGTTCTCCTCTGTGTCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002054
GCG MISSION shRNA Bacterial Glycerol Stock
glucagon
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002054.2-689s1c1
Sequence:CCGGCGTGGGATGTTTGAAATGTTACTCGAGTAACATTTCAAACATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002054.2-364s1c1
Sequence:CCGGGCCAAACGTCACGATGAATTTCTCGAGAAATTCATCGTGACGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002054.2-556s1c1
Sequence:CCGGGATGAGATGAACACCATTCTTCTCGAGAAGAATGGTGTTCATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002054.2-559s1c1
Sequence:CCGGGAGATGAACACCATTCTTGATCTCGAGATCAAGAATGGTGTTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002054.2-410s1c1
Sequence:CCGGCCAGTGATGTAAGTTCTTATTCTCGAGAATAAGAACTTACATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002054.2-969s21c1
Sequence:CCGGGATCTGACATATCTGCATTATCTCGAGATAATGCAGATATGTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002054.2-907s21c1
Sequence:CCGGCTGTTTACATTTAGCGATAAACTCGAGTTTATCGCTAAATGTAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002054.2-583s21c1
Sequence:CCGGCTTGCCGCCAGGGACTTTATACTCGAGTATAAAGTCCCTGGCGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002054
GCG MISSION shRNA shRNA Plasmid DNA
glucagon
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002054.2-689s1c1
Sequence:CCGGCGTGGGATGTTTGAAATGTTACTCGAGTAACATTTCAAACATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002054.2-364s1c1
Sequence:CCGGGCCAAACGTCACGATGAATTTCTCGAGAAATTCATCGTGACGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002054.2-556s1c1
Sequence:CCGGGATGAGATGAACACCATTCTTCTCGAGAAGAATGGTGTTCATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002054.2-559s1c1
Sequence:CCGGGAGATGAACACCATTCTTGATCTCGAGATCAAGAATGGTGTTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002054.2-410s1c1
Sequence:CCGGCCAGTGATGTAAGTTCTTATTCTCGAGAATAAGAACTTACATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002054.2-969s21c1
Sequence:CCGGGATCTGACATATCTGCATTATCTCGAGATAATGCAGATATGTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002054.2-907s21c1
Sequence:CCGGCTGTTTACATTTAGCGATAAACTCGAGTTTATCGCTAAATGTAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002054.2-583s21c1
Sequence:CCGGCTTGCCGCCAGGGACTTTATACTCGAGTATAAAGTCCCTGGCGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002054
GCG MISSION shRNA Lentiviral Transduction Particles
glucagon
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002054.2-689s1c1
Sequence:CCGGCGTGGGATGTTTGAAATGTTACTCGAGTAACATTTCAAACATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002054.2-364s1c1
Sequence:CCGGGCCAAACGTCACGATGAATTTCTCGAGAAATTCATCGTGACGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002054.2-556s1c1
Sequence:CCGGGATGAGATGAACACCATTCTTCTCGAGAAGAATGGTGTTCATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002054.2-559s1c1
Sequence:CCGGGAGATGAACACCATTCTTGATCTCGAGATCAAGAATGGTGTTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002054.2-410s1c1
Sequence:CCGGCCAGTGATGTAAGTTCTTATTCTCGAGAATAAGAACTTACATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002054.2-969s21c1
Sequence:CCGGGATCTGACATATCTGCATTATCTCGAGATAATGCAGATATGTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002054.2-907s21c1
Sequence:CCGGCTGTTTACATTTAGCGATAAACTCGAGTTTATCGCTAAATGTAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002054.2-583s21c1
Sequence:CCGGCTTGCCGCCAGGGACTTTATACTCGAGTATAAAGTCCCTGGCGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks