EMAIL THIS PAGE TO A FRIEND

GCGR

glucagon receptor

64 Gene Product Result for
Synonyms: GGR
UniProtKB ID: P47871, Q2M3M5
Gene ID:
Human(2642) Summary: The protein encoded by this gene is a glucagon receptor that is important in controlling blood glucose levels. Defects in this gene are a cause of non-insulin-dependent diabetes mellitus (NIDDM).[provided by RefSeq, Jan 2010]
Mouse(14527) glucagon receptor
Rat(24953) glucagon receptor
cow(515433) glucagon receptor
Horse(100055316) glucagon receptor
domestic cat(101099672) glucagon receptor
dog(483368) glucagon receptor
sheep(101115976) glucagon receptor
domestic guinea pig(100733098) glucagon receptor
naked mole-rat(101708959) glucagon receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000160 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU217681 MISSION® esiRNA esiRNA targeting human GCGR human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000160 Rosetta Predictions human pricing
NM_172091 Rosetta Predictions rat pricing
NM_172092 Rosetta Predictions rat pricing
NM_008101 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240226 predicted 691
2 SASI_Hs01_00240227 predicted 1413
3 SASI_Hs01_00240229 predicted 784
4 SASI_Hs01_00240230 predicted 1211
5 SASI_Hs01_00240231 predicted 1007
6 SASI_Hs01_00240232 predicted 1219
7 SASI_Hs01_00240233 predicted 622
8 SASI_Hs01_00240234 predicted 546
9 SASI_Hs01_00240235 predicted 1157
10 SASI_Hs02_00301979 predicted 1130
11 SASI_Hs01_00240228 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039213 predicted 799
2 SASI_Rn01_00039214 predicted 258
3 SASI_Rn01_00039215 predicted 618
4 SASI_Rn01_00039216 predicted 324
5 SASI_Rn01_00039217 predicted 356
6 SASI_Rn01_00039218 predicted 961
7 SASI_Rn01_00039219 predicted 695
8 SASI_Rn01_00039220 predicted 499
9 SASI_Rn01_00039221 predicted 719
10 SASI_Rn01_00039222 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076245 predicted 844
2 SASI_Rn01_00076246 predicted 297
3 SASI_Rn01_00076247 predicted 656
4 SASI_Rn01_00076248 predicted 359
5 SASI_Rn01_00076249 predicted 391
6 SASI_Rn01_00076250 predicted 997
7 SASI_Rn01_00076251 predicted 733
8 SASI_Rn01_00076252 predicted 545
9 SASI_Rn01_00076253 predicted 756
10 SASI_Rn01_00076254 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030570 predicted 342
2 SASI_Mm01_00030571 predicted 1524
3 SASI_Mm01_00030573 predicted 895
4 SASI_Mm01_00030575 predicted 1076
5 SASI_Mm01_00030577 predicted 357
6 SASI_Mm02_00313136 predicted 1037
7 SASI_Mm02_00313137 predicted 538
8 SASI_Mm01_00030578 predicted 1030
9 SASI_Mm02_00313138 predicted 1077
10 SASI_Mm01_00030579 predicted 453
11 SASI_Mm01_00030572 predicted 213
12 SASI_Mm01_00030574 predicted 616
13 SASI_Mm01_00030576 predicted 223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000160
GCGR MISSION shRNA Bacterial Glycerol Stock
glucagon receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000160.3-858s21c1
Sequence:CCGGAGCTCCGTGCTGGTCATTGATCTCGAGATCAATGACCAGCACGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000160.3-469s21c1
Sequence:CCGGACAGAACCTTCGACAAGTATTCTCGAGAATACTTGTCGAAGGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000160.3-835s21c1
Sequence:CCGGTTGCGTCCTTCGTGCTGAAAGCTCGAGCTTTCAGCACGAAGGACGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000160.1-1842s1c1
Sequence:CCGGAGTGTGGCTGTCTGCGAGATTCTCGAGAATCTCGCAGACAGCCACACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000160.1-1291s1c1
Sequence:CCGGGCACCACACAGACTACAAGTTCTCGAGAACTTGTAGTCTGTGTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000160.1-808s1c1
Sequence:CCGGCGCGAATCTGTTTGCGTCCTTCTCGAGAAGGACGCAAACAGATTCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000160.1-448s1c1
Sequence:CCGGGTGCAACAGAACCTTCGACAACTCGAGTTGTCGAAGGTTCTGTTGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000160.1-394s1c1
Sequence:CCGGCGGTGACCAGTGTCACCACAACTCGAGTTGTGGTGACACTGGTCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000160
GCGR MISSION shRNA shRNA Plasmid DNA
glucagon receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000160.3-858s21c1
Sequence:CCGGAGCTCCGTGCTGGTCATTGATCTCGAGATCAATGACCAGCACGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000160.3-469s21c1
Sequence:CCGGACAGAACCTTCGACAAGTATTCTCGAGAATACTTGTCGAAGGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000160.3-835s21c1
Sequence:CCGGTTGCGTCCTTCGTGCTGAAAGCTCGAGCTTTCAGCACGAAGGACGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000160.1-1842s1c1
Sequence:CCGGAGTGTGGCTGTCTGCGAGATTCTCGAGAATCTCGCAGACAGCCACACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000160.1-1291s1c1
Sequence:CCGGGCACCACACAGACTACAAGTTCTCGAGAACTTGTAGTCTGTGTGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000160.1-808s1c1
Sequence:CCGGCGCGAATCTGTTTGCGTCCTTCTCGAGAAGGACGCAAACAGATTCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000160.1-448s1c1
Sequence:CCGGGTGCAACAGAACCTTCGACAACTCGAGTTGTCGAAGGTTCTGTTGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000160.1-394s1c1
Sequence:CCGGCGGTGACCAGTGTCACCACAACTCGAGTTGTGGTGACACTGGTCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000160
GCGR MISSION shRNA Lentiviral Transduction Particles
glucagon receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000160.3-858s21c1
Sequence:CCGGAGCTCCGTGCTGGTCATTGATCTCGAGATCAATGACCAGCACGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000160.3-469s21c1
Sequence:CCGGACAGAACCTTCGACAAGTATTCTCGAGAATACTTGTCGAAGGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000160.3-835s21c1
Sequence:CCGGTTGCGTCCTTCGTGCTGAAAGCTCGAGCTTTCAGCACGAAGGACGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000160.1-1842s1c1
Sequence:CCGGAGTGTGGCTGTCTGCGAGATTCTCGAGAATCTCGCAGACAGCCACACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000160.1-1291s1c1
Sequence:CCGGGCACCACACAGACTACAAGTTCTCGAGAACTTGTAGTCTGTGTGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000160.1-808s1c1
Sequence:CCGGCGCGAATCTGTTTGCGTCCTTCTCGAGAAGGACGCAAACAGATTCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000160.1-448s1c1
Sequence:CCGGGTGCAACAGAACCTTCGACAACTCGAGTTGTCGAAGGTTCTGTTGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000160.1-394s1c1
Sequence:CCGGCGGTGACCAGTGTCACCACAACTCGAGTTGTGGTGACACTGGTCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008101
GCGR MISSION shRNA Bacterial Glycerol Stock
glucagon receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-793s1c1
Sequence:CCGGGTACGGCATCATACCCAACTACTCGAGTAGTTGGGTATGATGCCGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-1359s1c1
Sequence:CCGGGCAAAGCTCTTCAGGAGGAAACTCGAGTTTCCTCCTGAAGAGCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-193s1c1
Sequence:CCGGGTTTGAGAAGTGGAAGCTCTACTCGAGTAGAGCTTCCACTTCTCAAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-613s1c1
Sequence:CCGGCCGAAACTACATCCATGGGAACTCGAGTTCCCATGGATGTAGTTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-262s1c1
Sequence:CCGGGCTGGTCTGTAACAGAACCTTCTCGAGAAGGTTCTGTTACAGACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008101
GCGR MISSION shRNA shRNA Plasmid DNA
glucagon receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-793s1c1
Sequence:CCGGGTACGGCATCATACCCAACTACTCGAGTAGTTGGGTATGATGCCGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-1359s1c1
Sequence:CCGGGCAAAGCTCTTCAGGAGGAAACTCGAGTTTCCTCCTGAAGAGCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-193s1c1
Sequence:CCGGGTTTGAGAAGTGGAAGCTCTACTCGAGTAGAGCTTCCACTTCTCAAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-613s1c1
Sequence:CCGGCCGAAACTACATCCATGGGAACTCGAGTTCCCATGGATGTAGTTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-262s1c1
Sequence:CCGGGCTGGTCTGTAACAGAACCTTCTCGAGAAGGTTCTGTTACAGACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008101
GCGR MISSION shRNA Lentiviral Transduction Particles
glucagon receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-793s1c1
Sequence:CCGGGTACGGCATCATACCCAACTACTCGAGTAGTTGGGTATGATGCCGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-1359s1c1
Sequence:CCGGGCAAAGCTCTTCAGGAGGAAACTCGAGTTTCCTCCTGAAGAGCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-193s1c1
Sequence:CCGGGTTTGAGAAGTGGAAGCTCTACTCGAGTAGAGCTTCCACTTCTCAAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-613s1c1
Sequence:CCGGCCGAAACTACATCCATGGGAACTCGAGTTCCCATGGATGTAGTTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008101.1-262s1c1
Sequence:CCGGGCTGGTCTGTAACAGAACCTTCTCGAGAAGGTTCTGTTACAGACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)