EMAIL THIS PAGE TO A FRIEND

GCH1

GTP cyclohydrolase 1

151 Gene Product Result for
Synonyms: DYT14 DYT5 DYT5a GCH GTP-CH-1 GTPCH1 HPABH4B
UniProtKB ID: P30793, Q6FHY7, Q9Y4I8
Gene ID:
Human(2643) Summary: This gene encodes a member of the GTP cyclohydrolase family. The encoded protein is the first and rate-limiting enzyme in tetrahydrobiopterin (BH4) biosynthesis, catalyzing the conversion of GTP into 7,8-dihydroneopterin triphosphate. BH4 is an essential cofactor required by aromatic amino acid hydroxylases as well as nitric oxide synthases. Mutations in this gene are associated with malignant hyperphenylalaninemia and dopa-responsive dystonia. Several alternatively spliced transcript variants encoding different isoforms have been described; however, not all variants give rise to a functional enzyme. [provided by RefSeq, Jul 2008]
Mouse(14528) GTP cyclohydrolase 1
Rat(29244) GTP cyclohydrolase 1
Zebrafish(100192219) GTP cyclohydrolase 1
chicken(396146) GTP cyclohydrolase 1
dog(609393) GTP cyclohydrolase 1
cow(286815) GTP cyclohydrolase 1
domestic cat(101092120) GTP cyclohydrolase 1
naked mole-rat(101706667) GTP cyclohydrolase 1
domestic guinea pig(100735198) GTP cyclohydrolase 1
sheep(101112987) GTP cyclohydrolase 1
Domestic Rabbit(100286831) GTP cyclohydrolase 1
sheep(100303455) GTP cyclohydrolase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000161 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000161 Rosetta Predictions human pricing
NM_001024024 Rosetta Predictions human pricing
NM_001024070 Rosetta Predictions human pricing
NM_001024071 Rosetta Predictions human pricing
NM_024356 Rosetta Predictions rat pricing
NM_008102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203431 predicted 508
2 SASI_Hs02_00301980 predicted 490
3 SASI_Hs02_00301981 predicted 509
4 SASI_Hs01_00203432 predicted 892
5 SASI_Hs01_00203433 predicted 653
6 SASI_Hs01_00203434 predicted 610
7 SASI_Hs01_00203435 predicted 778
8 SASI_Hs01_00203436 predicted 800
9 SASI_Hs01_00203437 predicted 936
10 SASI_Hs01_00203438 predicted 883
11 SASI_Hs01_00203439 predicted 618
12 SASI_Hs01_00203440 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098708 predicted 508
2 SASI_Hs01_00098709 predicted 1149
3 SASI_Hs02_00307100 predicted 1137
4 SASI_Hs02_00307101 predicted 484
5 SASI_Hs02_00307102 predicted 511
6 SASI_Hs01_00098707 predicted 1141
7 SASI_Hs01_00098710 predicted 1108
8 SASI_Hs01_00098711 predicted 892
9 SASI_Hs01_00098712 predicted 1099
10 SASI_Hs01_00098713 predicted 1106
11 SASI_Hs01_00098714 predicted 1109
12 SASI_Hs01_00098715 predicted 617
13 SASI_Hs01_00098716 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229660 predicted 503
2 SASI_Hs01_00229661 predicted 1096
3 SASI_Hs02_00307103 predicted 1086
4 SASI_Hs02_00307104 predicted 493
5 SASI_Hs02_00307105 predicted 509
6 SASI_Hs01_00229659 predicted 1083
7 SASI_Hs01_00229662 predicted 1056
8 SASI_Hs02_00307106 predicted 783
9 SASI_Hs01_00229663 predicted 1047
10 SASI_Hs01_00229664 predicted 649
11 SASI_Hs01_00229665 predicted 1056
12 SASI_Hs01_00229666 predicted 1053
13 SASI_Hs01_00229667 predicted 621
14 SASI_Hs01_00229668 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090630 predicted 504
2 SASI_Hs01_00090631 predicted 1004
3 SASI_Hs02_00307107 predicted 1002
4 SASI_Hs02_00307108 predicted 487
5 SASI_Hs02_00307109 predicted 507
6 SASI_Hs01_00090629 predicted 1000
7 SASI_Hs01_00090632 predicted 973
8 SASI_Hs01_00090633 predicted 961
9 SASI_Hs01_00090634 predicted 649
10 SASI_Hs01_00090635 predicted 964
11 SASI_Hs01_00090636 predicted 962
12 SASI_Hs01_00090637 predicted 623
13 SASI_Hs01_00090638 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098344 predicted 441
2 SASI_Rn02_00263916 predicted 552
3 SASI_Rn01_00098345 predicted 610
4 SASI_Rn01_00098346 predicted 663
5 SASI_Rn02_00263917 predicted 554
6 SASI_Rn01_00098347 predicted 592
7 SASI_Rn01_00098348 predicted 705
8 SASI_Rn01_00098349 predicted 397
9 SASI_Rn01_00098350 predicted 602
10 SASI_Rn01_00098351 predicted 547
11 SASI_Rn01_00098343 predicted 743
12 SASI_Rn01_00098352 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163932 predicted 531
2 SASI_Mm02_00313139 predicted 1004
3 SASI_Mm02_00313140 predicted 555
4 SASI_Mm02_00313141 predicted 953
5 SASI_Mm02_00313142 predicted 963
6 SASI_Mm02_00313143 predicted 441
7 SASI_Mm01_00163933 predicted 449
8 SASI_Mm02_00313144 predicted 325
9 SASI_Mm01_00163935 predicted 938
10 SASI_Mm02_00313145 predicted 1006
11 SASI_Mm01_00163931 predicted 601
12 SASI_Mm01_00163934 predicted 503
13 SASI_Mm01_00163936 predicted 528
14 SASI_Mm01_00163937 predicted 730
15 SASI_Mm01_00163938 predicted 1087
16 SASI_Mm01_00163939 predicted 322
17 SASI_Mm01_00163940 predicted 753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000161
VALIDATED
GCH1 MISSION shRNA Bacterial Glycerol Stock
GTP cyclohydrolase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-829s1c1
Sequence:CCGGCAGCACAATGTTGGGTGTGTTCTCGAGAACACACCCAACATTGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-653s1c1
Sequence:CCGGGCGAGGATTGTAGAAATCTATCTCGAGATAGATTTCTACAATCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-770s1c1
Sequence:CCGGGCAACACACATGTGTATGGTACTCGAGTACCATACACATGTGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-604s1c1
Sequence:CCGGCCATATTGGTTATCTTCCTAACTCGAGTTAGGAAGATAACCAATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-491s1c1
Sequence:CCGGGATGTCCTAAACGATGCTATACTCGAGTATAGCATCGTTTAGGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000161.2-783s21c1
Sequence:CCGGGCAACACACATGTGTATGGTACTCGAGTACCATACACATGTGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000161.2-666s21c1
Sequence:CCGGGCGAGGATTGTAGAAATCTATCTCGAGATAGATTTCTACAATCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000161.2-617s21c1
Sequence:CCGGCCATATTGGTTATCTTCCTAACTCGAGTTAGGAAGATAACCAATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000161.2-842s21c1
Sequence:CCGGCAGCACAATGTTGGGTGTGTTCTCGAGAACACACCCAACATTGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000161
VALIDATED
GCH1 MISSION shRNA shRNA Plasmid DNA
GTP cyclohydrolase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-829s1c1
Sequence:CCGGCAGCACAATGTTGGGTGTGTTCTCGAGAACACACCCAACATTGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-653s1c1
Sequence:CCGGGCGAGGATTGTAGAAATCTATCTCGAGATAGATTTCTACAATCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-770s1c1
Sequence:CCGGGCAACACACATGTGTATGGTACTCGAGTACCATACACATGTGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-604s1c1
Sequence:CCGGCCATATTGGTTATCTTCCTAACTCGAGTTAGGAAGATAACCAATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-491s1c1
Sequence:CCGGGATGTCCTAAACGATGCTATACTCGAGTATAGCATCGTTTAGGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000161.2-783s21c1
Sequence:CCGGGCAACACACATGTGTATGGTACTCGAGTACCATACACATGTGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000161.2-666s21c1
Sequence:CCGGGCGAGGATTGTAGAAATCTATCTCGAGATAGATTTCTACAATCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000161.2-617s21c1
Sequence:CCGGCCATATTGGTTATCTTCCTAACTCGAGTTAGGAAGATAACCAATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000161.2-842s21c1
Sequence:CCGGCAGCACAATGTTGGGTGTGTTCTCGAGAACACACCCAACATTGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000161
VALIDATED
GCH1 MISSION shRNA Lentiviral Transduction Particles
GTP cyclohydrolase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-829s1c1
Sequence:CCGGCAGCACAATGTTGGGTGTGTTCTCGAGAACACACCCAACATTGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-653s1c1
Sequence:CCGGGCGAGGATTGTAGAAATCTATCTCGAGATAGATTTCTACAATCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-770s1c1
Sequence:CCGGGCAACACACATGTGTATGGTACTCGAGTACCATACACATGTGTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-604s1c1
Sequence:CCGGCCATATTGGTTATCTTCCTAACTCGAGTTAGGAAGATAACCAATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000161.1-491s1c1
Sequence:CCGGGATGTCCTAAACGATGCTATACTCGAGTATAGCATCGTTTAGGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000161.2-783s21c1
Sequence:CCGGGCAACACACATGTGTATGGTACTCGAGTACCATACACATGTGTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000161.2-666s21c1
Sequence:CCGGGCGAGGATTGTAGAAATCTATCTCGAGATAGATTTCTACAATCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000161.2-617s21c1
Sequence:CCGGCCATATTGGTTATCTTCCTAACTCGAGTTAGGAAGATAACCAATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000161.2-842s21c1
Sequence:CCGGCAGCACAATGTTGGGTGTGTTCTCGAGAACACACCCAACATTGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008102
VALIDATED
GCH1 MISSION shRNA Bacterial Glycerol Stock
GTP cyclohydrolase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008102.2-2049s1c1
Sequence:CCGGGCCAAATCAAATCGCAGCATTCTCGAGAATGCTGCGATTTGATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008102.2-577s1c1
Sequence:CCGGCTTCCTAACAAGCAAGTCCTTCTCGAGAAGGACTTGCTTGTTAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008102.2-731s1c1
Sequence:CCGGCGACACACATGTGCATGGTAACTCGAGTTACCATGCACATGTGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008102.2-601s1c1
Sequence:CCGGCTCAGTAAACTTGCCAGGATTCTCGAGAATCCTGGCAAGTTTACTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008102.2-414s1c1
Sequence:CCGGGCAGTACTTCACCAAGGGATACTCGAGTATCCCTTGGTGAAGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008102.3-1160s21c1
Sequence:CCGGGCATGCATTTGGTTGACATAACTCGAGTTATGTCAACCAAATGCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008102.3-551s21c1
Sequence:CCGGTTGTAGGAAGGGTCCATATTGCTCGAGCAATATGGACCCTTCCTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008102.3-731s21c1
Sequence:CCGGCGACACACATGTGCATGGTAACTCGAGTTACCATGCACATGTGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008102.3-601s21c1
Sequence:CCGGCTCAGTAAACTTGCCAGGATTCTCGAGAATCCTGGCAAGTTTACTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008102.3-414s21c1
Sequence:CCGGGCAGTACTTCACCAAGGGATACTCGAGTATCCCTTGGTGAAGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008102
VALIDATED
GCH1 MISSION shRNA shRNA Plasmid DNA
GTP cyclohydrolase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008102.2-2049s1c1
Sequence:CCGGGCCAAATCAAATCGCAGCATTCTCGAGAATGCTGCGATTTGATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008102.2-577s1c1
Sequence:CCGGCTTCCTAACAAGCAAGTCCTTCTCGAGAAGGACTTGCTTGTTAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008102.2-731s1c1
Sequence:CCGGCGACACACATGTGCATGGTAACTCGAGTTACCATGCACATGTGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008102.2-601s1c1
Sequence:CCGGCTCAGTAAACTTGCCAGGATTCTCGAGAATCCTGGCAAGTTTACTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008102.2-414s1c1
Sequence:CCGGGCAGTACTTCACCAAGGGATACTCGAGTATCCCTTGGTGAAGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008102.3-1160s21c1
Sequence:CCGGGCATGCATTTGGTTGACATAACTCGAGTTATGTCAACCAAATGCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008102.3-551s21c1
Sequence:CCGGTTGTAGGAAGGGTCCATATTGCTCGAGCAATATGGACCCTTCCTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008102.3-731s21c1
Sequence:CCGGCGACACACATGTGCATGGTAACTCGAGTTACCATGCACATGTGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008102.3-601s21c1
Sequence:CCGGCTCAGTAAACTTGCCAGGATTCTCGAGAATCCTGGCAAGTTTACTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008102.3-414s21c1
Sequence:CCGGGCAGTACTTCACCAAGGGATACTCGAGTATCCCTTGGTGAAGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008102
VALIDATED
GCH1 MISSION shRNA Lentiviral Transduction Particles
GTP cyclohydrolase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008102.2-2049s1c1
Sequence:CCGGGCCAAATCAAATCGCAGCATTCTCGAGAATGCTGCGATTTGATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008102.2-577s1c1
Sequence:CCGGCTTCCTAACAAGCAAGTCCTTCTCGAGAAGGACTTGCTTGTTAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008102.2-731s1c1
Sequence:CCGGCGACACACATGTGCATGGTAACTCGAGTTACCATGCACATGTGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008102.2-601s1c1
Sequence:CCGGCTCAGTAAACTTGCCAGGATTCTCGAGAATCCTGGCAAGTTTACTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008102.2-414s1c1
Sequence:CCGGGCAGTACTTCACCAAGGGATACTCGAGTATCCCTTGGTGAAGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008102.3-1160s21c1
Sequence:CCGGGCATGCATTTGGTTGACATAACTCGAGTTATGTCAACCAAATGCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008102.3-551s21c1
Sequence:CCGGTTGTAGGAAGGGTCCATATTGCTCGAGCAATATGGACCCTTCCTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008102.3-731s21c1
Sequence:CCGGCGACACACATGTGCATGGTAACTCGAGTTACCATGCACATGTGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008102.3-601s21c1
Sequence:CCGGCTCAGTAAACTTGCCAGGATTCTCGAGAATCCTGGCAAGTTTACTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008102.3-414s21c1
Sequence:CCGGGCAGTACTTCACCAAGGGATACTCGAGTATCCCTTGGTGAAGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)