EMAIL THIS PAGE TO A FRIEND

GCHFR

GTP cyclohydrolase I feedback regulator

50 Gene Product Result for
Synonyms: GFRP HsT16933 P35
UniProtKB ID: P30047, B2R4L6, Q2M1Q2, Q99749
Gene ID:
Human(2644) Summary: GTP cyclohydrolase I feedback regulatory protein binds to and mediates tetrahydrobiopterin inhibition of GTP cyclohydrolase I. The regulatory protein, GCHFR, consists of a homodimer. It is postulated that GCHFR may play a role in regulating phenylalanine metabolism in the liver and in the production of biogenic amine neurotransmitters and nitric oxide. [provided by RefSeq, Jul 2008]
Mouse(320415) GTP cyclohydrolase I feedback regulator
Rat(171128) GTP cyclohydrolase I feedback regulator
Zebrafish(393735) GTP cyclohydrolase I feedback regulator
chicken(423003) GTP cyclohydrolase I feedback regulator
dog(487498) GTP cyclohydrolase I feedback regulator
cow(617650) GTP cyclohydrolase I feedback regulator
domestic cat(101088493) GTP cyclohydrolase I feedback regulator
sheep(101110240) GTP cyclohydrolase I feedback regulator
domestic guinea pig(100717119) GTP cyclohydrolase I feedback regulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005258 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177157 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177157 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177157 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005258 Rosetta Predictions human pricing
NM_133595 Rosetta Predictions rat pricing
NM_177157 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032869 predicted 422
2 SASI_Hs01_00032871 predicted 276
3 SASI_Hs02_00339289 predicted 492
4 SASI_Hs01_00032872 predicted 424
5 SASI_Hs01_00032873 predicted 309
6 SASI_Hs02_00339290 predicted 320
7 SASI_Hs01_00032875 predicted 339
8 SASI_Hs01_00032876 predicted 338
9 SASI_Hs01_00032877 predicted 343
10 SASI_Hs01_00032878 predicted 250
11 SASI_Hs01_00032870 predicted 208
12 SASI_Hs01_00032874 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079464 predicted 209
2 SASI_Rn01_00079465 predicted 278
3 SASI_Rn01_00079466 predicted 368
4 SASI_Rn01_00079467 predicted 295
5 SASI_Rn01_00079469 predicted 403
6 SASI_Rn01_00079470 predicted 206
7 SASI_Rn01_00079471 predicted 372
8 SASI_Rn02_00267806 predicted 411
9 SASI_Rn01_00079472 predicted 377
10 SASI_Rn01_00079473 predicted 372
11 SASI_Rn01_00079468 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193710 predicted 368
2 SASI_Mm01_00193711 predicted 366
3 SASI_Mm01_00193712 predicted 342
4 SASI_Mm02_00347153 predicted 305
5 SASI_Mm01_00193714 predicted 361
6 SASI_Mm01_00193715 predicted 290
7 SASI_Mm01_00193716 predicted 344
8 SASI_Mm01_00193717 predicted 330
9 SASI_Mm01_00193718 predicted 293
10 SASI_Mm01_00193719 predicted 293
11 SASI_Mm01_00193713 predicted 307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005258
GCHFR MISSION shRNA Bacterial Glycerol Stock
GTP cyclohydrolase I feedback regulator
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005258.2-160s21c1
Sequence:CCGGACAGTCGGATCCAGAGCTGATCTCGAGATCAGCTCTGGATCCGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005258.2-338s21c1
Sequence:CCGGCACAAGGAGTGACCTTCTCATCTCGAGATGAGAAGGTCACTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005258.2-230s1c1
Sequence:CCGGGAATACTACGTCGATGACCCTCTCGAGAGGGTCATCGACGTAGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005258.2-204s1c1
Sequence:CCGGGAAGAGCCTTGGGAAACAACTCTCGAGAGTTGTTTCCCAAGGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005258.2-257s1c1
Sequence:CCGGATAGTCCTGGACAAGCTGGAACTCGAGTTCCAGCTTGTCCAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005258.2-285s1c1
Sequence:CCGGGCTTCCGTGTGCTGAGCATGACTCGAGTCATGCTCAGCACACGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005258
GCHFR MISSION shRNA shRNA Plasmid DNA
GTP cyclohydrolase I feedback regulator
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005258.2-160s21c1
Sequence:CCGGACAGTCGGATCCAGAGCTGATCTCGAGATCAGCTCTGGATCCGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005258.2-338s21c1
Sequence:CCGGCACAAGGAGTGACCTTCTCATCTCGAGATGAGAAGGTCACTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005258.2-230s1c1
Sequence:CCGGGAATACTACGTCGATGACCCTCTCGAGAGGGTCATCGACGTAGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005258.2-204s1c1
Sequence:CCGGGAAGAGCCTTGGGAAACAACTCTCGAGAGTTGTTTCCCAAGGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005258.2-257s1c1
Sequence:CCGGATAGTCCTGGACAAGCTGGAACTCGAGTTCCAGCTTGTCCAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005258.2-285s1c1
Sequence:CCGGGCTTCCGTGTGCTGAGCATGACTCGAGTCATGCTCAGCACACGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005258
GCHFR MISSION shRNA Lentiviral Transduction Particles
GTP cyclohydrolase I feedback regulator
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005258.2-160s21c1
Sequence:CCGGACAGTCGGATCCAGAGCTGATCTCGAGATCAGCTCTGGATCCGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005258.2-338s21c1
Sequence:CCGGCACAAGGAGTGACCTTCTCATCTCGAGATGAGAAGGTCACTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005258.2-230s1c1
Sequence:CCGGGAATACTACGTCGATGACCCTCTCGAGAGGGTCATCGACGTAGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005258.2-204s1c1
Sequence:CCGGGAAGAGCCTTGGGAAACAACTCTCGAGAGTTGTTTCCCAAGGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005258.2-257s1c1
Sequence:CCGGATAGTCCTGGACAAGCTGGAACTCGAGTTCCAGCTTGTCCAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005258.2-285s1c1
Sequence:CCGGGCTTCCGTGTGCTGAGCATGACTCGAGTCATGCTCAGCACACGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177157
GCHFR MISSION shRNA Bacterial Glycerol Stock
GTP cyclohydrolase I feedback regulator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177157.2-225s1c1
Sequence:CCGGCAAGCTGGAATGCAAGGGCTTCTCGAGAAGCCCTTGCATTCCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177157.2-373s1c1
Sequence:CCGGCCTGCCTATCTCTTTCCAAATCTCGAGATTTGGAAAGAGATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177157.2-159s1c1
Sequence:CCGGGAGAAGTGTCTTGGGAAACAACTCGAGTTGTTTCCCAAGACACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177157.2-187s1c1
Sequence:CCGGGAATACTACGTCAACGACCCTCTCGAGAGGGTCGTTGACGTAGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177157.2-284s1c1
Sequence:CCGGTGTGGTGTCTGCACAAGGAATCTCGAGATTCCTTGTGCAGACACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177157
GCHFR MISSION shRNA shRNA Plasmid DNA
GTP cyclohydrolase I feedback regulator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177157.2-225s1c1
Sequence:CCGGCAAGCTGGAATGCAAGGGCTTCTCGAGAAGCCCTTGCATTCCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177157.2-373s1c1
Sequence:CCGGCCTGCCTATCTCTTTCCAAATCTCGAGATTTGGAAAGAGATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177157.2-159s1c1
Sequence:CCGGGAGAAGTGTCTTGGGAAACAACTCGAGTTGTTTCCCAAGACACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177157.2-187s1c1
Sequence:CCGGGAATACTACGTCAACGACCCTCTCGAGAGGGTCGTTGACGTAGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177157.2-284s1c1
Sequence:CCGGTGTGGTGTCTGCACAAGGAATCTCGAGATTCCTTGTGCAGACACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177157
GCHFR MISSION shRNA Lentiviral Transduction Particles
GTP cyclohydrolase I feedback regulator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177157.2-225s1c1
Sequence:CCGGCAAGCTGGAATGCAAGGGCTTCTCGAGAAGCCCTTGCATTCCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177157.2-373s1c1
Sequence:CCGGCCTGCCTATCTCTTTCCAAATCTCGAGATTTGGAAAGAGATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177157.2-159s1c1
Sequence:CCGGGAGAAGTGTCTTGGGAAACAACTCGAGTTGTTTCCCAAGACACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177157.2-187s1c1
Sequence:CCGGGAATACTACGTCAACGACCCTCTCGAGAGGGTCGTTGACGTAGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177157.2-284s1c1
Sequence:CCGGTGTGGTGTCTGCACAAGGAATCTCGAGATTCCTTGTGCAGACACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks