EMAIL THIS PAGE TO A FRIEND

GCK

glucokinase (hexokinase 4)

107 Gene Product Result for
Synonyms: FGQTL3 GK GLK HHF3 HK4 HKIV HXKP LGLK MODY2
UniProtKB ID: P35557, A4D2J2, A4D2J3, Q05810
Gene ID:
Human(2645) Summary: Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. Alternative splicing of this gene results in three tissue-specific forms of glucokinase, one found in pancreatic islet beta cells and two found in liver. The protein localizes to the outer membrane of mitochondria. In contrast to other forms of hexokinase, this enzyme is not inhibited by its product glucose-6-phosphate but remains active while glucose is abundant. Mutations in this gene have been associated with non-insulin dependent diabetes mellitus (NIDDM), maturity onset diabetes of the young, type 2 (MODY2) and persistent hyperinsulinemic hypoglycemia of infancy (PHHI). [provided by RefSeq, Apr 2009]
Mouse(103988) glucokinase
Rat(24385) glucokinase
domestic guinea pig(100717630) glucokinase (hexokinase 4)
naked mole-rat(101721664) glucokinase (hexokinase 4)
sheep(101117412) glucokinase (hexokinase 4)
Zebrafish(751668) glucokinase (hexokinase 4, maturity onset diabetes of the young 2)
domestic cat(100037406) glucokinase (hexokinase 4)
cow(616576) glucokinase (hexokinase 4)
Horse(100051836) glucokinase (hexokinase 4)
dog(606490) glucokinase (hexokinase 4)
chicken(430370) glucokinase (hexokinase 4)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK091 Hexokinase Colorimetric Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033507 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010292 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010292 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010292 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152071 MISSION® esiRNA esiRNA human GCK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000162 Rosetta Predictions human pricing
NM_033507 Rosetta Predictions human pricing
NM_033508 Rosetta Predictions human pricing
NM_012565 Rosetta Predictions rat pricing
NM_010292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209666 predicted 1088
2 SASI_Hs02_00301982 predicted 2149
3 SASI_Hs02_00301983 predicted 2141
4 SASI_Hs02_00301984 predicted 916
5 SASI_Hs02_00301985 predicted 2137
6 SASI_Hs01_00209670 predicted 1846
7 SASI_Hs01_00209671 predicted 1496
8 SASI_Hs02_00301986 predicted 2112
9 SASI_Hs02_00301987 predicted 2138
10 SASI_Hs01_00209672 predicted 1688
11 SASI_Hs01_00209667 predicted 784
12 SASI_Hs01_00209668 predicted 840
13 SASI_Hs01_00209669 predicted 1236
14 SASI_Hs01_00209673 predicted 822
15 SASI_Hs01_00209674 predicted 1285
16 SASI_Hs01_00209675 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163756 predicted 785
2 SASI_Hs02_00361380 predicted 1851
3 SASI_Hs02_00361381 predicted 1836
4 SASI_Hs02_00361382 predicted 617
5 SASI_Hs02_00361383 predicted 1832
6 SASI_Hs01_00163760 predicted 1543
7 SASI_Hs01_00163761 predicted 1203
8 SASI_Hs02_00361384 predicted 1812
9 SASI_Hs02_00361385 predicted 1840
10 SASI_Hs01_00163762 predicted 1387
11 SASI_Hs01_00163757 predicted 471
12 SASI_Hs01_00163758 predicted 526
13 SASI_Hs01_00163759 predicted 923
14 SASI_Hs01_00163763 predicted 507
15 SASI_Hs01_00163764 predicted 974
16 SASI_Hs01_00163765 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235656 predicted 908
2 SASI_Hs02_00361386 predicted 1976
3 SASI_Hs02_00361387 predicted 1960
4 SASI_Hs02_00361388 predicted 740
5 SASI_Hs02_00361389 predicted 1960
6 SASI_Hs01_00235660 predicted 1666
7 SASI_Hs01_00235661 predicted 1324
8 SASI_Hs02_00361390 predicted 1933
9 SASI_Hs02_00361391 predicted 1968
10 SASI_Hs01_00235662 predicted 1512
11 SASI_Hs01_00235657 predicted 597
12 SASI_Hs01_00235658 predicted 651
13 SASI_Hs01_00235659 predicted 1045
14 SASI_Hs01_00235663 predicted 633
15 SASI_Hs01_00235664 predicted 1092
16 SASI_Hs01_00235665 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037618 predicted 1393
2 SASI_Rn01_00037619 predicted 954
3 SASI_Rn01_00037620 predicted 304
4 SASI_Rn01_00037621 predicted 342
5 SASI_Rn01_00037622 predicted 740
6 SASI_Rn02_00259677 predicted 1117
7 SASI_Rn01_00037623 predicted 1482
8 SASI_Rn01_00037624 predicted 995
9 SASI_Rn01_00037625 predicted 616
10 SASI_Rn01_00037626 predicted 1219
11 SASI_Rn01_00037627 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170486 predicted 206
2 SASI_Mm01_00170487 predicted 1298
3 SASI_Mm01_00170488 predicted 196
4 SASI_Mm01_00170490 predicted 298
5 SASI_Mm01_00170491 predicted 1090
6 SASI_Mm01_00170492 predicted 528
7 SASI_Mm01_00170493 predicted 646
8 SASI_Mm01_00170494 predicted 406
9 SASI_Mm01_00170495 predicted 202
10 SASI_Mm02_00318262 predicted 899
11 SASI_Mm01_00170489 predicted 1444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033507
GCK MISSION shRNA Bacterial Glycerol Stock
glucokinase (hexokinase 4)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.x-1200s1c1
Sequence:CCGGCGACCGCAAGCAGATCTACAACTCGAGTTGTAGATCTGCTTGCGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.x-534s1c1
Sequence:CCGGGCTCTTCGACTACATCTCTGACTCGAGTCAGAGATGTAGTCGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.x-813s1c1
Sequence:CCGGCTACGAAGACCATCAGTGCGACTCGAGTCGCACTGATGGTCTTCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.x-727s1c1
Sequence:CCGGCGAGACGCTATCAAACGGAGACTCGAGTCTCCGTTTGATAGCGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033507.1-205s1c1
Sequence:CCGGGCCTTGACTCTGGTAGAGCAGCTCGAGCTGCTCTACCAGAGTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.1-1041s1c1
Sequence:CCGGGAAGCTCATAGGTGGCAAGTACTCGAGTACTTGCCACCTATGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.1-1392s1c1
Sequence:CCGGCGTGGATGGCTCCGTGTACAACTCGAGTTGTACACGGAGCCATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.1-570s1c1
Sequence:CCGGCCTGGACAAGCATCAGATGAACTCGAGTTCATCTGATGCTTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033507.1-1856s1c1
Sequence:CCGGCTCAGGACTTTGATGCATTTCCTCGAGGAAATGCATCAAAGTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033507.1-1815s1c1
Sequence:CCGGCCTTTCTCGCTGGAATCAATTCTCGAGAATTGATTCCAGCGAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.1-1365s1c1
Sequence:CCGGCGAGGACGTAATGCGCATCACCTCGAGGTGATGCGCATTACGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033507
GCK MISSION shRNA shRNA Plasmid DNA
glucokinase (hexokinase 4)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.x-1200s1c1
Sequence:CCGGCGACCGCAAGCAGATCTACAACTCGAGTTGTAGATCTGCTTGCGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.x-534s1c1
Sequence:CCGGGCTCTTCGACTACATCTCTGACTCGAGTCAGAGATGTAGTCGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.x-813s1c1
Sequence:CCGGCTACGAAGACCATCAGTGCGACTCGAGTCGCACTGATGGTCTTCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.x-727s1c1
Sequence:CCGGCGAGACGCTATCAAACGGAGACTCGAGTCTCCGTTTGATAGCGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033507.1-205s1c1
Sequence:CCGGGCCTTGACTCTGGTAGAGCAGCTCGAGCTGCTCTACCAGAGTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.1-1041s1c1
Sequence:CCGGGAAGCTCATAGGTGGCAAGTACTCGAGTACTTGCCACCTATGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.1-1392s1c1
Sequence:CCGGCGTGGATGGCTCCGTGTACAACTCGAGTTGTACACGGAGCCATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.1-570s1c1
Sequence:CCGGCCTGGACAAGCATCAGATGAACTCGAGTTCATCTGATGCTTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033507.1-1856s1c1
Sequence:CCGGCTCAGGACTTTGATGCATTTCCTCGAGGAAATGCATCAAAGTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033507.1-1815s1c1
Sequence:CCGGCCTTTCTCGCTGGAATCAATTCTCGAGAATTGATTCCAGCGAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.1-1365s1c1
Sequence:CCGGCGAGGACGTAATGCGCATCACCTCGAGGTGATGCGCATTACGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033507
GCK MISSION shRNA Lentiviral Transduction Particles
glucokinase (hexokinase 4)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.x-1200s1c1
Sequence:CCGGCGACCGCAAGCAGATCTACAACTCGAGTTGTAGATCTGCTTGCGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.x-534s1c1
Sequence:CCGGGCTCTTCGACTACATCTCTGACTCGAGTCAGAGATGTAGTCGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.x-813s1c1
Sequence:CCGGCTACGAAGACCATCAGTGCGACTCGAGTCGCACTGATGGTCTTCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.x-727s1c1
Sequence:CCGGCGAGACGCTATCAAACGGAGACTCGAGTCTCCGTTTGATAGCGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033507.1-205s1c1
Sequence:CCGGGCCTTGACTCTGGTAGAGCAGCTCGAGCTGCTCTACCAGAGTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.1-1041s1c1
Sequence:CCGGGAAGCTCATAGGTGGCAAGTACTCGAGTACTTGCCACCTATGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.1-1392s1c1
Sequence:CCGGCGTGGATGGCTCCGTGTACAACTCGAGTTGTACACGGAGCCATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.1-570s1c1
Sequence:CCGGCCTGGACAAGCATCAGATGAACTCGAGTTCATCTGATGCTTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033507.1-1856s1c1
Sequence:CCGGCTCAGGACTTTGATGCATTTCCTCGAGGAAATGCATCAAAGTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033507.1-1815s1c1
Sequence:CCGGCCTTTCTCGCTGGAATCAATTCTCGAGAATTGATTCCAGCGAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033507.1-1365s1c1
Sequence:CCGGCGAGGACGTAATGCGCATCACCTCGAGGTGATGCGCATTACGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010292
GCK MISSION shRNA Bacterial Glycerol Stock
glucokinase (hexokinase 4)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010292.3-1913s1c1
Sequence:CCGGCCAGAGACAGTCTCCTTCATACTCGAGTATGAAGGAGACTGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010292.3-638s1c1
Sequence:CCGGGCTACTATGAAGACCGCCAATCTCGAGATTGGCGGTCTTCATAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010292.3-1296s1c1
Sequence:CCGGCAACTGCGAAATCACCTTCATCTCGAGATGAAGGTGATTTCGCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010292.3-211s1c1
Sequence:CCGGGTTGGAGACTTTCTCTCCTTACTCGAGTAAGGAGAGAAAGTCTCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010292.3-408s1c1
Sequence:CCGGGCATCAGATGAAACACAAGAACTCGAGTTCTTGTGTTTCATCTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010292
GCK MISSION shRNA shRNA Plasmid DNA
glucokinase (hexokinase 4)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010292.3-1913s1c1
Sequence:CCGGCCAGAGACAGTCTCCTTCATACTCGAGTATGAAGGAGACTGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010292.3-638s1c1
Sequence:CCGGGCTACTATGAAGACCGCCAATCTCGAGATTGGCGGTCTTCATAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010292.3-1296s1c1
Sequence:CCGGCAACTGCGAAATCACCTTCATCTCGAGATGAAGGTGATTTCGCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010292.3-211s1c1
Sequence:CCGGGTTGGAGACTTTCTCTCCTTACTCGAGTAAGGAGAGAAAGTCTCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010292.3-408s1c1
Sequence:CCGGGCATCAGATGAAACACAAGAACTCGAGTTCTTGTGTTTCATCTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010292
GCK MISSION shRNA Lentiviral Transduction Particles
glucokinase (hexokinase 4)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010292.3-1913s1c1
Sequence:CCGGCCAGAGACAGTCTCCTTCATACTCGAGTATGAAGGAGACTGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010292.3-638s1c1
Sequence:CCGGGCTACTATGAAGACCGCCAATCTCGAGATTGGCGGTCTTCATAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010292.3-1296s1c1
Sequence:CCGGCAACTGCGAAATCACCTTCATCTCGAGATGAAGGTGATTTCGCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010292.3-211s1c1
Sequence:CCGGGTTGGAGACTTTCTCTCCTTACTCGAGTAAGGAGAGAAAGTCTCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010292.3-408s1c1
Sequence:CCGGGCATCAGATGAAACACAAGAACTCGAGTTCTTGTGTTTCATCTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks