EMAIL THIS PAGE TO A FRIEND

GCKR

glucokinase (hexokinase 4) regulator

49 Gene Product Result for
Synonyms: FGQTL5 GKRP
UniProtKB ID: Q14397, A1L4C2, Q53RY6, Q99522
Gene ID:
Human(2646) Summary: This gene encodes a protein belonging to the GCKR subfamily of the SIS (Sugar ISomerase) family of proteins. The gene product is a regulatory protein that inhibits glucokinase in liver and pancreatic islet cells by binding non-covalently to form an inactive complex with the enzyme. This gene is considered a susceptibility gene candidate for a form of maturity-onset diabetes of the young (MODY). [provided by RefSeq, Jul 2008]
Mouse(231103) glucokinase regulatory protein
Rat(25658) glucokinase (hexokinase 4) regulator
dog(475705) glucokinase (hexokinase 4) regulator
Horse(100071177) glucokinase (hexokinase 4) regulator
cow(100140421) glucokinase (hexokinase 4) regulator
sheep(101112303) glucokinase (hexokinase 4) regulator
naked mole-rat(101718746) glucokinase (hexokinase 4) regulator
domestic guinea pig(100728544) glucokinase (hexokinase 4) regulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001486 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120941 MISSION® esiRNA esiRNA human GCKR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001486 Rosetta Predictions human pricing
NM_013120 Rosetta Predictions rat pricing
NM_144909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124706 predicted 1430
2 SASI_Hs01_00124707 predicted 411
3 SASI_Hs01_00124708 predicted 1116
4 SASI_Hs02_00331967 predicted 1940
5 SASI_Hs01_00124710 predicted 1486
6 SASI_Hs01_00124711 predicted 523
7 SASI_Hs01_00124712 predicted 264
8 SASI_Hs02_00331968 predicted 1502
9 SASI_Hs01_00124713 predicted 1271
10 SASI_Hs01_00124714 predicted 886
11 SASI_Hs01_00124709 predicted 1919
12 SASI_Hs01_00124715 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109234 predicted 499
2 SASI_Rn01_00109235 predicted 584
3 SASI_Rn01_00109236 predicted 998
4 SASI_Rn01_00109237 predicted 1277
5 SASI_Rn01_00109238 predicted 1183
6 SASI_Rn01_00109239 predicted 1628
7 SASI_Rn01_00109241 predicted 1405
8 SASI_Rn01_00109242 predicted 1542
9 SASI_Rn01_00109243 predicted 1566
10 SASI_Rn02_00260898 predicted 629
11 SASI_Rn01_00109240 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137961 predicted 1390
2 SASI_Mm01_00137962 predicted 401
3 SASI_Mm01_00137963 predicted 867
4 SASI_Mm01_00137964 predicted 1300
5 SASI_Mm01_00137965 predicted 658
6 SASI_Mm01_00137966 predicted 484
7 SASI_Mm01_00137967 predicted 1530
8 SASI_Mm01_00137968 predicted 427
9 SASI_Mm01_00137969 predicted 895
10 SASI_Mm01_00137970 predicted 368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001486
GCKR MISSION shRNA Bacterial Glycerol Stock
glucokinase (hexokinase 4) regulator
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-145s1c1
Sequence:CCGGGCTGTGCCAATCACGGAGAAGCTCGAGCTTCTCCGTGATTGGCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001486.2-1116s1c1
Sequence:CCGGCCACACCTTTGGTGCTGATTTCTCGAGAAATCAGCACCAAAGGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001486.2-1948s1c1
Sequence:CCGGCATGTTTCTGGGTGGGTGAAACTCGAGTTTCACCCACCCAGAAACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-411s1c1
Sequence:CCGGCCTCATGTCGGTGTCCTTTAACTCGAGTTAAAGGACACCGACATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-1163s1c1
Sequence:CCGGGTGATCACAGTGACATGTTTACTCGAGTAAACATGTCACTGTGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-732s1c1
Sequence:CCGGGAGTTCAACATTCCGACAAGTCTCGAGACTTGTCGGAATGTTGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-1701s1c1
Sequence:CCGGCCAGCCACTGTCAGATGATATCTCGAGATATCATCTGACAGTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-1587s1c1
Sequence:CCGGCCTTCGGATTAGCAACTCCAACTCGAGTTGGAGTTGCTAATCCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-568s1c1
Sequence:CCGGGCCGGGAAGAAGAGAGTGATTCTCGAGAATCACTCTCTTCTTCCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-205s1c1
Sequence:CCGGGAGAACATTGTTCGACTGCTACTCGAGTAGCAGTCGAACAATGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-943s1c1
Sequence:CCGGCTGGAAATCTTGCGGACATTTCTCGAGAAATGTCCGCAAGATTTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001486
GCKR MISSION shRNA shRNA Plasmid DNA
glucokinase (hexokinase 4) regulator
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-145s1c1
Sequence:CCGGGCTGTGCCAATCACGGAGAAGCTCGAGCTTCTCCGTGATTGGCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001486.2-1116s1c1
Sequence:CCGGCCACACCTTTGGTGCTGATTTCTCGAGAAATCAGCACCAAAGGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001486.2-1948s1c1
Sequence:CCGGCATGTTTCTGGGTGGGTGAAACTCGAGTTTCACCCACCCAGAAACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-411s1c1
Sequence:CCGGCCTCATGTCGGTGTCCTTTAACTCGAGTTAAAGGACACCGACATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-1163s1c1
Sequence:CCGGGTGATCACAGTGACATGTTTACTCGAGTAAACATGTCACTGTGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-732s1c1
Sequence:CCGGGAGTTCAACATTCCGACAAGTCTCGAGACTTGTCGGAATGTTGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-1701s1c1
Sequence:CCGGCCAGCCACTGTCAGATGATATCTCGAGATATCATCTGACAGTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-1587s1c1
Sequence:CCGGCCTTCGGATTAGCAACTCCAACTCGAGTTGGAGTTGCTAATCCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-568s1c1
Sequence:CCGGGCCGGGAAGAAGAGAGTGATTCTCGAGAATCACTCTCTTCTTCCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-205s1c1
Sequence:CCGGGAGAACATTGTTCGACTGCTACTCGAGTAGCAGTCGAACAATGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-943s1c1
Sequence:CCGGCTGGAAATCTTGCGGACATTTCTCGAGAAATGTCCGCAAGATTTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001486
GCKR MISSION shRNA Lentiviral Transduction Particles
glucokinase (hexokinase 4) regulator
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-145s1c1
Sequence:CCGGGCTGTGCCAATCACGGAGAAGCTCGAGCTTCTCCGTGATTGGCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001486.2-1116s1c1
Sequence:CCGGCCACACCTTTGGTGCTGATTTCTCGAGAAATCAGCACCAAAGGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001486.2-1948s1c1
Sequence:CCGGCATGTTTCTGGGTGGGTGAAACTCGAGTTTCACCCACCCAGAAACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-411s1c1
Sequence:CCGGCCTCATGTCGGTGTCCTTTAACTCGAGTTAAAGGACACCGACATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-1163s1c1
Sequence:CCGGGTGATCACAGTGACATGTTTACTCGAGTAAACATGTCACTGTGATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-732s1c1
Sequence:CCGGGAGTTCAACATTCCGACAAGTCTCGAGACTTGTCGGAATGTTGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-1701s1c1
Sequence:CCGGCCAGCCACTGTCAGATGATATCTCGAGATATCATCTGACAGTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-1587s1c1
Sequence:CCGGCCTTCGGATTAGCAACTCCAACTCGAGTTGGAGTTGCTAATCCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-568s1c1
Sequence:CCGGGCCGGGAAGAAGAGAGTGATTCTCGAGAATCACTCTCTTCTTCCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-205s1c1
Sequence:CCGGGAGAACATTGTTCGACTGCTACTCGAGTAGCAGTCGAACAATGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001486.2-943s1c1
Sequence:CCGGCTGGAAATCTTGCGGACATTTCTCGAGAAATGTCCGCAAGATTTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144909
GCKR MISSION shRNA Bacterial Glycerol Stock
glucokinase (hexokinase 4) regulator
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144909.1-1859s1c1
Sequence:CCGGCCAGTAATACACGTTGCAGGACTCGAGTCCTGCAACGTGTATTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144909.1-1378s1c1
Sequence:CCGGGCTCCTCTAAAGAAGCTCTTTCTCGAGAAAGAGCTTCTTTAGAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144909.1-679s1c1
Sequence:CCGGGCCAGAAATGATCCCATTGAACTCGAGTTCAATGGGATCATTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144909.1-1050s1c1
Sequence:CCGGCCTCGGTATCATCGCCATTATCTCGAGATAATGGCGATGATACCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144909.1-154s1c1
Sequence:CCGGCGGAACTTGGACAAAGCAGATCTCGAGATCTGCTTTGTCCAAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144909.1-1229s21c1
Sequence:CCGGTGCCATCCCTTACGGAAATTGCTCGAGCAATTTCCGTAAGGGATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144909.1-1098s21c1
Sequence:CCGGTGGTGCTGATTTCCGAGATATCTCGAGATATCTCGGAAATCAGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144909.1-1049s21c1
Sequence:CCGGCCCTCGGTATCATCGCCATTACTCGAGTAATGGCGATGATACCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144909.1-555s21c1
Sequence:CCGGAGTGGTCGTTATAGGCATTTCCTCGAGGAAATGCCTATAACGACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144909
GCKR MISSION shRNA shRNA Plasmid DNA
glucokinase (hexokinase 4) regulator
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144909.1-1859s1c1
Sequence:CCGGCCAGTAATACACGTTGCAGGACTCGAGTCCTGCAACGTGTATTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144909.1-1378s1c1
Sequence:CCGGGCTCCTCTAAAGAAGCTCTTTCTCGAGAAAGAGCTTCTTTAGAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144909.1-679s1c1
Sequence:CCGGGCCAGAAATGATCCCATTGAACTCGAGTTCAATGGGATCATTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144909.1-1050s1c1
Sequence:CCGGCCTCGGTATCATCGCCATTATCTCGAGATAATGGCGATGATACCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144909.1-154s1c1
Sequence:CCGGCGGAACTTGGACAAAGCAGATCTCGAGATCTGCTTTGTCCAAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144909.1-1229s21c1
Sequence:CCGGTGCCATCCCTTACGGAAATTGCTCGAGCAATTTCCGTAAGGGATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144909.1-1098s21c1
Sequence:CCGGTGGTGCTGATTTCCGAGATATCTCGAGATATCTCGGAAATCAGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144909.1-1049s21c1
Sequence:CCGGCCCTCGGTATCATCGCCATTACTCGAGTAATGGCGATGATACCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144909.1-555s21c1
Sequence:CCGGAGTGGTCGTTATAGGCATTTCCTCGAGGAAATGCCTATAACGACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144909
GCKR MISSION shRNA Lentiviral Transduction Particles
glucokinase (hexokinase 4) regulator
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144909.1-1859s1c1
Sequence:CCGGCCAGTAATACACGTTGCAGGACTCGAGTCCTGCAACGTGTATTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144909.1-1378s1c1
Sequence:CCGGGCTCCTCTAAAGAAGCTCTTTCTCGAGAAAGAGCTTCTTTAGAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144909.1-679s1c1
Sequence:CCGGGCCAGAAATGATCCCATTGAACTCGAGTTCAATGGGATCATTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144909.1-1050s1c1
Sequence:CCGGCCTCGGTATCATCGCCATTATCTCGAGATAATGGCGATGATACCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144909.1-154s1c1
Sequence:CCGGCGGAACTTGGACAAAGCAGATCTCGAGATCTGCTTTGTCCAAGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144909.1-1229s21c1
Sequence:CCGGTGCCATCCCTTACGGAAATTGCTCGAGCAATTTCCGTAAGGGATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144909.1-1098s21c1
Sequence:CCGGTGGTGCTGATTTCCGAGATATCTCGAGATATCTCGGAAATCAGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144909.1-1049s21c1
Sequence:CCGGCCCTCGGTATCATCGCCATTACTCGAGTAATGGCGATGATACCGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144909.1-555s21c1
Sequence:CCGGAGTGGTCGTTATAGGCATTTCCTCGAGGAAATGCCTATAACGACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)