EMAIL THIS PAGE TO A FRIEND

GCLC

glutamate-cysteine ligase, catalytic subunit

Synonyms: GCL GCS GLCL GLCLC
UniProtKB ID: P48506, Q14399
Gene ID:
Human(2729) Summary: Glutamate-cysteine ligase, also known as gamma-glutamylcysteine synthetase is the first rate-limiting enzyme of glutathione synthesis. The enzyme consists of two subunits, a heavy catalytic subunit and a light regulatory subunit. This locus encodes the catalytic subunit, while the regulatory subunit is derived from a different gene located on chromosome 1p22-p21. Mutations at this locus have been associated with hemolytic anemia due to deficiency of gamma-glutamylcysteine synthetase and susceptibility to myocardial infarction.[provided by RefSeq, Oct 2010]
Mouse(14629) glutamate-cysteine ligase, catalytic subunit
Rat(25283) glutamate-cysteine ligase, catalytic subunit
Zebrafish(326857) glutamate-cysteine ligase, catalytic subunit
chicken(421894) glutamate-cysteine ligase, catalytic subunit
dog(609822) glutamate-cysteine ligase, catalytic subunit
Horse(100056731) glutamate-cysteine ligase, catalytic subunit
cow(512468) glutamate-cysteine ligase, catalytic subunit
domestic cat(101096568) glutamate-cysteine ligase, catalytic subunit
fruit fly(53581) Glutamate-cysteine ligase catalytic subunit
domestic guinea pig(100726181) glutamate-cysteine ligase, catalytic subunit
naked mole-rat(101718793) glutamate-cysteine ligase, catalytic subunit
sheep(101114822) glutamate-cysteine ligase, catalytic subunit
Domestic Rabbit(100342383) glutamate-cysteine ligase, catalytic subunit
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
B2515 L-Buthionine-sulfoximine ≥97% (TLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001498 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001498 Rosetta Predictions human pricing
NM_012815 Rosetta Predictions rat pricing
NM_010295 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189238 predicted 2036
2 SASI_Hs01_00189239 predicted 1555
3 SASI_Hs01_00189240 predicted 1703
4 SASI_Hs01_00189241 predicted 993
5 SASI_Hs01_00189242 predicted 1638
6 SASI_Hs01_00189243 predicted 2378
7 SASI_Hs01_00189244 predicted 1370
8 SASI_Hs01_00189245 predicted 1381
9 SASI_Hs01_00189246 predicted 2053
10 SASI_Hs01_00189247 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043357 predicted 871
2 SASI_Rn01_00043359 predicted 1718
3 SASI_Rn01_00043360 predicted 827
4 SASI_Rn01_00043361 predicted 751
5 SASI_Rn01_00043362 predicted 1843
6 SASI_Rn01_00043364 predicted 1862
7 SASI_Rn01_00043365 predicted 1375
8 SASI_Rn01_00043366 predicted 1336
9 SASI_Rn02_00260264 predicted 340
10 SASI_Rn02_00260265 predicted 691
11 SASI_Rn01_00043358 predicted 849
12 SASI_Rn01_00043363 predicted 2076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142670 predicted 768
2 SASI_Mm02_00318266 predicted 1672
3 SASI_Mm01_00142671 predicted 623
4 SASI_Mm01_00142672 predicted 957
5 SASI_Mm01_00142673 predicted 776
6 SASI_Mm01_00142674 predicted 1271
7 SASI_Mm01_00142675 predicted 1663
8 SASI_Mm01_00142676 predicted 1323
9 SASI_Mm01_00142678 predicted 1112
10 SASI_Mm01_00142679 predicted 1332
11 SASI_Mm01_00142677 predicted 1851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001498
VALIDATED
GCLC MISSION shRNA Bacterial Glycerol Stock
glutamate-cysteine ligase, catalytic subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-992s21c1
Sequence:CCGGGTCATCAATGTACCAATATTTCTCGAGAAATATTGGTACATTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-1077s21c1
Sequence:CCGGCTTCTAAGCCGGATCATATTTCTCGAGAAATATGATCCGGCTTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-2788s21c1
Sequence:CCGGTGAAAGTGCTTCAAGGGTAATCTCGAGATTACCCTTGAAGCACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-1333s21c1
Sequence:CCGGGCCATTGAAGAACAATAACTACTCGAGTAGTTATTGTTCTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-1994s21c1
Sequence:CCGGCCAATTCTGAACTCTTACCTTCTCGAGAAGGTAAGAGTTCAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001498.2-1744s1c1
Sequence:CCGGCCTTTCCTACAAATTGGATTTCTCGAGAAATCCAATTTGTAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001498.2-1247s1c1
Sequence:CCGGCGAGGCTATGTGTCAGACATTCTCGAGAATGTCTGACACATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001498.2-1085s1c1
Sequence:CCGGCCGGATCATATTTACATGGATCTCGAGATCCATGTAAATATGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001498.2-1333s1c1
Sequence:CCGGGCCATTGAAGAACAATAACTACTCGAGTAGTTATTGTTCTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001498.2-1994s1c1
Sequence:CCGGCCAATTCTGAACTCTTACCTTCTCGAGAAGGTAAGAGTTCAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001498
VALIDATED
GCLC MISSION shRNA shRNA Plasmid DNA
glutamate-cysteine ligase, catalytic subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-992s21c1
Sequence:CCGGGTCATCAATGTACCAATATTTCTCGAGAAATATTGGTACATTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-1077s21c1
Sequence:CCGGCTTCTAAGCCGGATCATATTTCTCGAGAAATATGATCCGGCTTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-2788s21c1
Sequence:CCGGTGAAAGTGCTTCAAGGGTAATCTCGAGATTACCCTTGAAGCACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-1333s21c1
Sequence:CCGGGCCATTGAAGAACAATAACTACTCGAGTAGTTATTGTTCTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-1994s21c1
Sequence:CCGGCCAATTCTGAACTCTTACCTTCTCGAGAAGGTAAGAGTTCAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001498.2-1744s1c1
Sequence:CCGGCCTTTCCTACAAATTGGATTTCTCGAGAAATCCAATTTGTAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001498.2-1247s1c1
Sequence:CCGGCGAGGCTATGTGTCAGACATTCTCGAGAATGTCTGACACATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001498.2-1085s1c1
Sequence:CCGGCCGGATCATATTTACATGGATCTCGAGATCCATGTAAATATGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001498.2-1333s1c1
Sequence:CCGGGCCATTGAAGAACAATAACTACTCGAGTAGTTATTGTTCTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001498.2-1994s1c1
Sequence:CCGGCCAATTCTGAACTCTTACCTTCTCGAGAAGGTAAGAGTTCAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001498
VALIDATED
GCLC MISSION shRNA Lentiviral Transduction Particles
glutamate-cysteine ligase, catalytic subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-992s21c1
Sequence:CCGGGTCATCAATGTACCAATATTTCTCGAGAAATATTGGTACATTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-1077s21c1
Sequence:CCGGCTTCTAAGCCGGATCATATTTCTCGAGAAATATGATCCGGCTTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-2788s21c1
Sequence:CCGGTGAAAGTGCTTCAAGGGTAATCTCGAGATTACCCTTGAAGCACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-1333s21c1
Sequence:CCGGGCCATTGAAGAACAATAACTACTCGAGTAGTTATTGTTCTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001498.2-1994s21c1
Sequence:CCGGCCAATTCTGAACTCTTACCTTCTCGAGAAGGTAAGAGTTCAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001498.2-1744s1c1
Sequence:CCGGCCTTTCCTACAAATTGGATTTCTCGAGAAATCCAATTTGTAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001498.2-1247s1c1
Sequence:CCGGCGAGGCTATGTGTCAGACATTCTCGAGAATGTCTGACACATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001498.2-1085s1c1
Sequence:CCGGCCGGATCATATTTACATGGATCTCGAGATCCATGTAAATATGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001498.2-1333s1c1
Sequence:CCGGGCCATTGAAGAACAATAACTACTCGAGTAGTTATTGTTCTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001498.2-1994s1c1
Sequence:CCGGCCAATTCTGAACTCTTACCTTCTCGAGAAGGTAAGAGTTCAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010295
VALIDATED
GCLC MISSION shRNA Bacterial Glycerol Stock
glutamate-cysteine ligase, catalytic subunit
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010295.1-1356s21c1
Sequence:CCGGCCTCTCATACAAACTAGACTTCTCGAGAAGTCTAGTTTGTATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010295.1-1933s21c1
Sequence:CCGGAGAGAGGGTGATCGCTGTTTACTCGAGTAAACAGCGATCACCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010295.1-981s21c1
Sequence:CCGGTCGGTATGACTCAATAGATAGCTCGAGCTATCTATTGAGTCATACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010295.1-604s21c1
Sequence:CCGGGTCATCAATGTGCCAATATTCCTCGAGGAATATTGGCACATTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010295.1-1653s21c1
Sequence:CCGGCCGATGCAGTATTCTGAACTACTCGAGTAGTTCAGAATACTGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010295.1-770s1c1
Sequence:CCGGGCAGCATATCTGAGGCAAGATCTCGAGATCTTGCCTCAGATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010295.1-1356s1c1
Sequence:CCGGCCTCTCATACAAACTAGACTTCTCGAGAAGTCTAGTTTGTATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010295.1-1653s1c1
Sequence:CCGGCCGATGCAGTATTCTGAACTACTCGAGTAGTTCAGAATACTGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010295
VALIDATED
GCLC MISSION shRNA shRNA Plasmid DNA
glutamate-cysteine ligase, catalytic subunit
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010295.1-1356s21c1
Sequence:CCGGCCTCTCATACAAACTAGACTTCTCGAGAAGTCTAGTTTGTATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010295.1-1933s21c1
Sequence:CCGGAGAGAGGGTGATCGCTGTTTACTCGAGTAAACAGCGATCACCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010295.1-981s21c1
Sequence:CCGGTCGGTATGACTCAATAGATAGCTCGAGCTATCTATTGAGTCATACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010295.1-604s21c1
Sequence:CCGGGTCATCAATGTGCCAATATTCCTCGAGGAATATTGGCACATTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010295.1-1653s21c1
Sequence:CCGGCCGATGCAGTATTCTGAACTACTCGAGTAGTTCAGAATACTGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010295.1-770s1c1
Sequence:CCGGGCAGCATATCTGAGGCAAGATCTCGAGATCTTGCCTCAGATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010295.1-1356s1c1
Sequence:CCGGCCTCTCATACAAACTAGACTTCTCGAGAAGTCTAGTTTGTATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010295.1-1653s1c1
Sequence:CCGGCCGATGCAGTATTCTGAACTACTCGAGTAGTTCAGAATACTGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010295
VALIDATED
GCLC MISSION shRNA Lentiviral Transduction Particles
glutamate-cysteine ligase, catalytic subunit
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010295.1-1356s21c1
Sequence:CCGGCCTCTCATACAAACTAGACTTCTCGAGAAGTCTAGTTTGTATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010295.1-1933s21c1
Sequence:CCGGAGAGAGGGTGATCGCTGTTTACTCGAGTAAACAGCGATCACCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010295.1-981s21c1
Sequence:CCGGTCGGTATGACTCAATAGATAGCTCGAGCTATCTATTGAGTCATACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010295.1-604s21c1
Sequence:CCGGGTCATCAATGTGCCAATATTCCTCGAGGAATATTGGCACATTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010295.1-1653s21c1
Sequence:CCGGCCGATGCAGTATTCTGAACTACTCGAGTAGTTCAGAATACTGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010295.1-770s1c1
Sequence:CCGGGCAGCATATCTGAGGCAAGATCTCGAGATCTTGCCTCAGATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010295.1-1356s1c1
Sequence:CCGGCCTCTCATACAAACTAGACTTCTCGAGAAGTCTAGTTTGTATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010295.1-1653s1c1
Sequence:CCGGCCGATGCAGTATTCTGAACTACTCGAGTAGTTCAGAATACTGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks