EMAIL THIS PAGE TO A FRIEND

GCLM

glutamate-cysteine ligase, modifier subunit

Synonyms: GLCLR
UniProtKB ID: P48507, A8K334, D3DT45, Q6FHC1, Q9NPX9, Q9NU74
Gene ID:
Human(2730) Summary: Glutamate-cysteine ligase, also known as gamma-glutamylcysteine synthetase, is the first rate limiting enzyme of glutathione synthesis. The enzyme consists of two subunits, a heavy catalytic subunit and a light regulatory subunit. Gamma glutamylcysteine synthetase deficiency has been implicated in some forms of hemolytic anemia. [provided by RefSeq, Jul 2008]
Mouse(14630) glutamate-cysteine ligase, modifier subunit
Rat(29739) glutamate cysteine ligase, modifier subunit
sheep(101117899) glutamate-cysteine ligase, modifier subunit
naked mole-rat(101703324) glutamate-cysteine ligase, modifier subunit
domestic guinea pig(100725164) glutamate-cysteine ligase, modifier subunit
Zebrafish(333974) glutamate-cysteine ligase, modifier subunit
cow(525659) glutamate-cysteine ligase, modifier subunit
domestic cat(101081562) glutamate-cysteine ligase, modifier subunit
dog(612283) glutamate-cysteine ligase, modifier subunit
chicken(424492) glutamate-cysteine ligase, modifier subunit
fruit fly(248194) Glutamate-cysteine ligase modifier subunit
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
B2515 L-Buthionine-sulfoximine ≥97% (TLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008129 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008129 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008129 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002061 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002061 Rosetta Predictions human pricing
NM_017305 Rosetta Predictions rat pricing
NM_008129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188141 predicted 414
2 SASI_Hs02_00333111 predicted 566
3 SASI_Hs01_00188142 predicted 439
4 SASI_Hs01_00188143 predicted 815
5 SASI_Hs01_00188144 predicted 471
6 SASI_Hs02_00333112 predicted 1121
7 SASI_Hs01_00188147 predicted 769
8 SASI_Hs01_00188148 predicted 1032
9 SASI_Hs02_00333113 predicted 524
10 SASI_Hs01_00188149 predicted 1138
11 SASI_Hs01_00188145 predicted 839
12 SASI_Hs01_00188146 predicted 698
13 SASI_Hs01_00188150 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036443 predicted 659
2 SASI_Rn01_00036444 predicted 291
3 SASI_Rn01_00036446 predicted 393
4 SASI_Rn01_00036447 predicted 242
5 SASI_Rn01_00036448 predicted 665
6 SASI_Rn01_00036449 predicted 293
7 SASI_Rn02_00261749 predicted 709
8 SASI_Rn01_00036450 predicted 639
9 SASI_Rn01_00036451 predicted 407
10 SASI_Rn01_00036452 predicted 518
11 SASI_Rn01_00036445 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031013 predicted 679
2 SASI_Mm02_00313189 predicted 832
3 SASI_Mm01_00031014 predicted 824
4 SASI_Mm01_00031015 predicted 935
5 SASI_Mm01_00031016 predicted 796
6 SASI_Mm01_00031017 predicted 911
7 SASI_Mm01_00031018 predicted 776
8 SASI_Mm01_00031019 predicted 672
9 SASI_Mm01_00031020 predicted 603
10 SASI_Mm01_00031022 predicted 878
11 SASI_Mm01_00031021 predicted 991
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008129
GCLM MISSION shRNA Bacterial Glycerol Stock
glutamate-cysteine ligase, modifier subunit
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008129.2-1248s1c1
Sequence:CCGGCCTGCTGTTGTCTGGAACATACTCGAGTATGTTCCAGACAACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008129.2-801s1c1
Sequence:CCGGGTTAATCTTTCCTTGGAGCATCTCGAGATGCTCCAAGGAAAGATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008129.2-784s1c1
Sequence:CCGGCTCCGATTGAAGATGGAGTTACTCGAGTAACTCCATCTTCAATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008129.2-573s1c1
Sequence:CCGGCCCGATTTAGTCAGGGAGTTTCTCGAGAAACTCCCTGACTAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008129.2-984s1c1
Sequence:CCGGCCACCAGATTTGACTGCCTTTCTCGAGAAAGGCAGTCAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008129.3-572s21c1
Sequence:CCGGCCCGATTTAGTCAGGGAGTTTCTCGAGAAACTCCCTGACTAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008129.3-800s21c1
Sequence:CCGGGTTAATCTTTCCTTGGAGCATCTCGAGATGCTCCAAGGAAAGATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008129.3-783s21c1
Sequence:CCGGCTCCGATTGAAGATGGAGTTACTCGAGTAACTCCATCTTCAATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008129
GCLM MISSION shRNA shRNA Plasmid DNA
glutamate-cysteine ligase, modifier subunit
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008129.2-1248s1c1
Sequence:CCGGCCTGCTGTTGTCTGGAACATACTCGAGTATGTTCCAGACAACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008129.2-801s1c1
Sequence:CCGGGTTAATCTTTCCTTGGAGCATCTCGAGATGCTCCAAGGAAAGATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008129.2-784s1c1
Sequence:CCGGCTCCGATTGAAGATGGAGTTACTCGAGTAACTCCATCTTCAATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008129.2-573s1c1
Sequence:CCGGCCCGATTTAGTCAGGGAGTTTCTCGAGAAACTCCCTGACTAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008129.2-984s1c1
Sequence:CCGGCCACCAGATTTGACTGCCTTTCTCGAGAAAGGCAGTCAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008129.3-572s21c1
Sequence:CCGGCCCGATTTAGTCAGGGAGTTTCTCGAGAAACTCCCTGACTAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008129.3-800s21c1
Sequence:CCGGGTTAATCTTTCCTTGGAGCATCTCGAGATGCTCCAAGGAAAGATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008129.3-783s21c1
Sequence:CCGGCTCCGATTGAAGATGGAGTTACTCGAGTAACTCCATCTTCAATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008129
GCLM MISSION shRNA Lentiviral Transduction Particles
glutamate-cysteine ligase, modifier subunit
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008129.2-1248s1c1
Sequence:CCGGCCTGCTGTTGTCTGGAACATACTCGAGTATGTTCCAGACAACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008129.2-801s1c1
Sequence:CCGGGTTAATCTTTCCTTGGAGCATCTCGAGATGCTCCAAGGAAAGATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008129.2-784s1c1
Sequence:CCGGCTCCGATTGAAGATGGAGTTACTCGAGTAACTCCATCTTCAATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008129.2-573s1c1
Sequence:CCGGCCCGATTTAGTCAGGGAGTTTCTCGAGAAACTCCCTGACTAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008129.2-984s1c1
Sequence:CCGGCCACCAGATTTGACTGCCTTTCTCGAGAAAGGCAGTCAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008129.3-572s21c1
Sequence:CCGGCCCGATTTAGTCAGGGAGTTTCTCGAGAAACTCCCTGACTAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008129.3-800s21c1
Sequence:CCGGGTTAATCTTTCCTTGGAGCATCTCGAGATGCTCCAAGGAAAGATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008129.3-783s21c1
Sequence:CCGGCTCCGATTGAAGATGGAGTTACTCGAGTAACTCCATCTTCAATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002061
VALIDATED
GCLM MISSION shRNA Bacterial Glycerol Stock
glutamate-cysteine ligase, modifier subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-431s1c1
Sequence:CCGGCCAGATTTGGTCAGGGAGTTTCTCGAGAAACTCCCTGACCAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-641s1c1
Sequence:CCGGCCTCCTATTGAAGATGGAGTTCTCGAGAACTCCATCTTCAATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-923s1c1
Sequence:CCGGGCAAGTTTCCAAGAAGCTCTTCTCGAGAAGAGCTTCTTGGAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-842s1c1
Sequence:CCGGCCACCAGATTTGACTGCATTTCTCGAGAAATGCAGTCAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-669s1c1
Sequence:CCGGCCTTGGAGCATTTACAGCCTTCTCGAGAAGGCTGTAAATGCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-1217s21c1
Sequence:CCGGGCAGATATTCTTTCGTCATATCTCGAGATATGACGAAAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-963s21c1
Sequence:CCGGGCAAGTTTCCAAGAAGCTCTTCTCGAGAAGAGCTTCTTGGAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-681s21c1
Sequence:CCGGCCTCCTATTGAAGATGGAGTTCTCGAGAACTCCATCTTCAATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-882s21c1
Sequence:CCGGCCACCAGATTTGACTGCATTTCTCGAGAAATGCAGTCAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-840s21c1
Sequence:CCGGCCAAATAGTAACCAAGTTAATCTCGAGATTAACTTGGTTACTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002061
VALIDATED
GCLM MISSION shRNA shRNA Plasmid DNA
glutamate-cysteine ligase, modifier subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-431s1c1
Sequence:CCGGCCAGATTTGGTCAGGGAGTTTCTCGAGAAACTCCCTGACCAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-641s1c1
Sequence:CCGGCCTCCTATTGAAGATGGAGTTCTCGAGAACTCCATCTTCAATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-923s1c1
Sequence:CCGGGCAAGTTTCCAAGAAGCTCTTCTCGAGAAGAGCTTCTTGGAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-842s1c1
Sequence:CCGGCCACCAGATTTGACTGCATTTCTCGAGAAATGCAGTCAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-669s1c1
Sequence:CCGGCCTTGGAGCATTTACAGCCTTCTCGAGAAGGCTGTAAATGCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-1217s21c1
Sequence:CCGGGCAGATATTCTTTCGTCATATCTCGAGATATGACGAAAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-963s21c1
Sequence:CCGGGCAAGTTTCCAAGAAGCTCTTCTCGAGAAGAGCTTCTTGGAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-681s21c1
Sequence:CCGGCCTCCTATTGAAGATGGAGTTCTCGAGAACTCCATCTTCAATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-882s21c1
Sequence:CCGGCCACCAGATTTGACTGCATTTCTCGAGAAATGCAGTCAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-840s21c1
Sequence:CCGGCCAAATAGTAACCAAGTTAATCTCGAGATTAACTTGGTTACTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002061
VALIDATED
GCLM MISSION shRNA Lentiviral Transduction Particles
glutamate-cysteine ligase, modifier subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-431s1c1
Sequence:CCGGCCAGATTTGGTCAGGGAGTTTCTCGAGAAACTCCCTGACCAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-641s1c1
Sequence:CCGGCCTCCTATTGAAGATGGAGTTCTCGAGAACTCCATCTTCAATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-923s1c1
Sequence:CCGGGCAAGTTTCCAAGAAGCTCTTCTCGAGAAGAGCTTCTTGGAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-842s1c1
Sequence:CCGGCCACCAGATTTGACTGCATTTCTCGAGAAATGCAGTCAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002061.1-669s1c1
Sequence:CCGGCCTTGGAGCATTTACAGCCTTCTCGAGAAGGCTGTAAATGCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-1217s21c1
Sequence:CCGGGCAGATATTCTTTCGTCATATCTCGAGATATGACGAAAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-963s21c1
Sequence:CCGGGCAAGTTTCCAAGAAGCTCTTCTCGAGAAGAGCTTCTTGGAAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-681s21c1
Sequence:CCGGCCTCCTATTGAAGATGGAGTTCTCGAGAACTCCATCTTCAATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-882s21c1
Sequence:CCGGCCACCAGATTTGACTGCATTTCTCGAGAAATGCAGTCAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002061.2-840s21c1
Sequence:CCGGCCAAATAGTAACCAAGTTAATCTCGAGATTAACTTGGTTACTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks