EMAIL THIS PAGE TO A FRIEND

GCM1

glial cells missing homolog 1 (Drosophila)

64 Gene Product Result for
Synonyms: GCMA hGCMa
UniProtKB ID: Q9NP62, Q4VAQ7, Q5T0X0, Q99468, Q9P1X3
Gene ID:
Human(8521) Summary: This gene encodes a DNA-binding protein with a gcm-motif (glial cell missing motif). The encoded protein is a homolog of the Drosophila glial cells missing gene (gcm). This protein binds to the GCM-motif (A/G)CCCGCAT, a novel sequence among known targets of DNA-binding proteins. The N-terminal DNA-binding domain confers the unique DNA-binding activity of this protein. [provided by RefSeq, Jul 2008]
Mouse(14531) glial cells missing homolog 1 (Drosophila)
Rat(29394) glial cells missing homolog 1 (Drosophila)
chicken(404300) glial cells missing homolog 1 (Drosophila)
dog(481844) glial cells missing homolog 1 (Drosophila)
cow(317779) glial cells missing homolog 1 (Drosophila)
Horse(100056683) glial cells missing homolog 1 (Drosophila)
domestic cat(101085890) glial cells missing homolog 1 (Drosophila)
domestic guinea pig(100729523) glial cells missing homolog 1 (Drosophila)
naked mole-rat(101717075) glial cells missing homolog 1 (Drosophila)
sheep(101108000) glial cells missing homolog 1 (Drosophila)
Domestic Rabbit(100341874) glial cells missing homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV100837 Anti-GCM1 (AB1) antibody produced in rabbit affinity isolated antibody human, canine, horse, rabbit
western blot pricing
AV100836 Anti-GCM1 (AB2) antibody produced in rabbit affinity isolated antibody, lyophilized powder human, rat, mouse, canine
western blot pricing
SAB2107860 Anti-GCM1 antibody produced in rabbit affinity isolated antibody mouse, rat, human, canine
western blot pricing
SAB2105255 Anti-GCM1 antibody produced in rabbit affinity isolated antibody mouse
western blot pricing
HPA011343 Anti-GCM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2105256 Anti-GCM1, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, horse, mouse
western blot pricing
WH0008521M3 Monoclonal Anti-GCM1 antibody produced in mouse clone 3G7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1404592 Monoclonal Anti-GCM1 antibody produced in mouse clone 2E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1409908 Monoclonal Anti-GCM1 antibody produced in mouse clone 3D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409909 Monoclonal Anti-GCM1 antibody produced in mouse clone 3G5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409910 Monoclonal Anti-GCM1 antibody produced in mouse clone 3D2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409911 Monoclonal Anti-GCM1 antibody produced in mouse clone 4C11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409907 Monoclonal Anti-GCM1 antibody produced in mouse clone 4E8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003643 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU043881 MISSION® esiRNA esiRNA targeting mouse Gcm1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003643 Rosetta Predictions human pricing
NM_017186 Rosetta Predictions rat pricing
NM_008103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187189 predicted 1279
2 SASI_Hs01_00187190 predicted 251
3 SASI_Hs01_00187191 predicted 238
4 SASI_Hs01_00187192 predicted 1075
5 SASI_Hs01_00187193 predicted 853
6 SASI_Hs01_00187194 predicted 931
7 SASI_Hs01_00187195 predicted 1071
8 SASI_Hs01_00187196 predicted 929
9 SASI_Hs01_00187197 predicted 841
10 SASI_Hs01_00187198 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080022 predicted 1210
2 SASI_Rn01_00080023 predicted 792
3 SASI_Rn01_00080024 predicted 1229
4 SASI_Rn01_00080025 predicted 807
5 SASI_Rn01_00080026 predicted 1276
6 SASI_Rn01_00080027 predicted 750
7 SASI_Rn02_00261522 predicted 893
8 SASI_Rn01_00080029 predicted 741
9 SASI_Rn01_00080030 predicted 202
10 SASI_Rn02_00261523 predicted 416
11 SASI_Rn01_00080028 predicted 256
12 SASI_Rn01_00080031 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146946 predicted 873
2 SASI_Mm02_00313146 predicted 783
3 SASI_Mm01_00146947 predicted 947
4 SASI_Mm01_00146948 predicted 1554
5 SASI_Mm01_00146949 predicted 941
6 SASI_Mm01_00146950 predicted 961
7 SASI_Mm01_00146951 predicted 832
8 SASI_Mm01_00146952 predicted 1092
9 SASI_Mm01_00146953 predicted 219
10 SASI_Mm02_00313147 predicted 384
11 SASI_Mm01_00146945 predicted 1475
12 SASI_Mm01_00146954 predicted 1051
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003643
GCM1 MISSION shRNA Bacterial Glycerol Stock
glial cells missing homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003643.3-856s21c1
Sequence:CCGGGTAGTTACAGTGGACATTTAACTCGAGTTAAATGTCCACTGTAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003643.3-1086s21c1
Sequence:CCGGGATCTACAAGCGTGGAGTAAACTCGAGTTTACTCCACGCTTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003643.3-621s21c1
Sequence:CCGGAGGCACGACGGACGCTTTATACTCGAGTATAAAGCGTCCGTCGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003643.2-1612s1c1
Sequence:CCGGCCACAGATAAATGAGAATCATCTCGAGATGATTCTCATTTATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003643.2-1287s1c1
Sequence:CCGGCCAGCGGGTAATCTTTATGAACTCGAGTTCATAAAGATTACCCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003643.2-1347s1c1
Sequence:CCGGCCTGCATACCATTCACCTCAACTCGAGTTGAGGTGAATGGTATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003643.2-245s1c1
Sequence:CCGGAGAGATATTAAGCTGGGATATCTCGAGATATCCCAGCTTAATATCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003643.2-891s1c1
Sequence:CCGGCCTCAGCAGAACTCACTAAATCTCGAGATTTAGTGAGTTCTGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003643
GCM1 MISSION shRNA shRNA Plasmid DNA
glial cells missing homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003643.3-856s21c1
Sequence:CCGGGTAGTTACAGTGGACATTTAACTCGAGTTAAATGTCCACTGTAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003643.3-1086s21c1
Sequence:CCGGGATCTACAAGCGTGGAGTAAACTCGAGTTTACTCCACGCTTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003643.3-621s21c1
Sequence:CCGGAGGCACGACGGACGCTTTATACTCGAGTATAAAGCGTCCGTCGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003643.2-1612s1c1
Sequence:CCGGCCACAGATAAATGAGAATCATCTCGAGATGATTCTCATTTATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003643.2-1287s1c1
Sequence:CCGGCCAGCGGGTAATCTTTATGAACTCGAGTTCATAAAGATTACCCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003643.2-1347s1c1
Sequence:CCGGCCTGCATACCATTCACCTCAACTCGAGTTGAGGTGAATGGTATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003643.2-245s1c1
Sequence:CCGGAGAGATATTAAGCTGGGATATCTCGAGATATCCCAGCTTAATATCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003643.2-891s1c1
Sequence:CCGGCCTCAGCAGAACTCACTAAATCTCGAGATTTAGTGAGTTCTGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003643
GCM1 MISSION shRNA Lentiviral Transduction Particles
glial cells missing homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003643.3-856s21c1
Sequence:CCGGGTAGTTACAGTGGACATTTAACTCGAGTTAAATGTCCACTGTAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003643.3-1086s21c1
Sequence:CCGGGATCTACAAGCGTGGAGTAAACTCGAGTTTACTCCACGCTTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003643.3-621s21c1
Sequence:CCGGAGGCACGACGGACGCTTTATACTCGAGTATAAAGCGTCCGTCGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003643.2-1612s1c1
Sequence:CCGGCCACAGATAAATGAGAATCATCTCGAGATGATTCTCATTTATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003643.2-1287s1c1
Sequence:CCGGCCAGCGGGTAATCTTTATGAACTCGAGTTCATAAAGATTACCCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003643.2-1347s1c1
Sequence:CCGGCCTGCATACCATTCACCTCAACTCGAGTTGAGGTGAATGGTATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003643.2-245s1c1
Sequence:CCGGAGAGATATTAAGCTGGGATATCTCGAGATATCCCAGCTTAATATCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003643.2-891s1c1
Sequence:CCGGCCTCAGCAGAACTCACTAAATCTCGAGATTTAGTGAGTTCTGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008103
GCM1 MISSION shRNA Bacterial Glycerol Stock
glial cells missing homolog 1 (Drosophila)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008103.3-1514s21c1
Sequence:CCGGTCTCTCTCCCAGTCGTGATTTCTCGAGAAATCACGACTGGGAGAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008103.3-781s21c1
Sequence:CCGGGTCAGGGAAGTTTACCTTTAACTCGAGTTAAAGGTAAACTTCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008103.2-234s1c1
Sequence:CCGGTGGGACATTAACGATGTGAAACTCGAGTTTCACATCGTTAATGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008103.2-1472s1c1
Sequence:CCGGGCTCCTAAACTTCTGTTCTTTCTCGAGAAAGAACAGAAGTTTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008103.2-880s1c1
Sequence:CCGGCCCTGAATGATTGCTTATCCTCTCGAGAGGATAAGCAATCATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008103.2-881s1c1
Sequence:CCGGCCTGAATGATTGCTTATCCTTCTCGAGAAGGATAAGCAATCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008103.2-1655s1c1
Sequence:CCGGCCAGTGTGTTTACCCTCCATACTCGAGTATGGAGGGTAAACACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008103
GCM1 MISSION shRNA shRNA Plasmid DNA
glial cells missing homolog 1 (Drosophila)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008103.3-1514s21c1
Sequence:CCGGTCTCTCTCCCAGTCGTGATTTCTCGAGAAATCACGACTGGGAGAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008103.3-781s21c1
Sequence:CCGGGTCAGGGAAGTTTACCTTTAACTCGAGTTAAAGGTAAACTTCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008103.2-234s1c1
Sequence:CCGGTGGGACATTAACGATGTGAAACTCGAGTTTCACATCGTTAATGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008103.2-1472s1c1
Sequence:CCGGGCTCCTAAACTTCTGTTCTTTCTCGAGAAAGAACAGAAGTTTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008103.2-880s1c1
Sequence:CCGGCCCTGAATGATTGCTTATCCTCTCGAGAGGATAAGCAATCATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008103.2-881s1c1
Sequence:CCGGCCTGAATGATTGCTTATCCTTCTCGAGAAGGATAAGCAATCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008103.2-1655s1c1
Sequence:CCGGCCAGTGTGTTTACCCTCCATACTCGAGTATGGAGGGTAAACACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008103
GCM1 MISSION shRNA Lentiviral Transduction Particles
glial cells missing homolog 1 (Drosophila)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008103.3-1514s21c1
Sequence:CCGGTCTCTCTCCCAGTCGTGATTTCTCGAGAAATCACGACTGGGAGAGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008103.3-781s21c1
Sequence:CCGGGTCAGGGAAGTTTACCTTTAACTCGAGTTAAAGGTAAACTTCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008103.2-234s1c1
Sequence:CCGGTGGGACATTAACGATGTGAAACTCGAGTTTCACATCGTTAATGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008103.2-1472s1c1
Sequence:CCGGGCTCCTAAACTTCTGTTCTTTCTCGAGAAAGAACAGAAGTTTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008103.2-880s1c1
Sequence:CCGGCCCTGAATGATTGCTTATCCTCTCGAGAGGATAAGCAATCATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008103.2-881s1c1
Sequence:CCGGCCTGAATGATTGCTTATCCTTCTCGAGAAGGATAAGCAATCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008103.2-1655s1c1
Sequence:CCGGCCAGTGTGTTTACCCTCCATACTCGAGTATGGAGGGTAAACACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks