EMAIL THIS PAGE TO A FRIEND

GCM2

glial cells missing homolog 2 (Drosophila)

58 Gene Product Result for
Synonyms: GCMB hGCMb
UniProtKB ID: O75603, Q5THN5
Gene ID:
Human(9247) Summary: This gene is a homolog of the Drosophila glial cells missing gene, which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. [provided by RefSeq, Jul 2008]
Mouse(107889) glial cells missing homolog 2 (Drosophila)
Rat(291047) glial cells missing homolog 2 (Drosophila)
sheep(101105538) glial cells missing homolog 2 (Drosophila)
naked mole-rat(101699688) glial cells missing homolog 2 (Drosophila)
domestic guinea pig(100723814) glial cells missing homolog 2 (Drosophila)
Zebrafish(449615) glial cells missing homolog 2 (Drosophila)
chicken(428478) glial cells missing homolog 2 (Drosophila)
fruit fly(34280) CG3858 gene product from transcript CG3858-RA
cow(539454) glial cells missing homolog 2 (Drosophila)
Horse(100051412) glial cells missing homolog 2 (Drosophila)
domestic cat(101093605) glial cells missing homolog 2 (Drosophila)
dog(488217) glial cells missing homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008104 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008104 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008104 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004752 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137001 MISSION® esiRNA esiRNA human GCM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004752 Rosetta Predictions human pricing
NM_001106105 Rosetta Predictions rat pricing
NM_008104 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073953 predicted 681
2 SASI_Hs01_00073954 predicted 929
3 SASI_Hs01_00073955 predicted 1067
4 SASI_Hs01_00073957 predicted 408
5 SASI_Hs01_00073958 predicted 579
6 SASI_Hs01_00073959 predicted 1099
7 SASI_Hs02_00338237 predicted 1208
8 SASI_Hs02_00338238 predicted 984
9 SASI_Hs02_00338239 predicted 1034
10 SASI_Hs02_00338240 predicted 1021
11 SASI_Hs01_00073956 predicted 709
12 SASI_Hs01_00073960 predicted 951
13 SASI_Hs01_00073961 predicted 1329
14 SASI_Hs01_00073962 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215672 predicted 921
2 SASI_Rn02_00215673 predicted 1025
3 SASI_Rn02_00215674 predicted 1714
4 SASI_Rn02_00215675 predicted 933
5 SASI_Rn02_00215676 predicted 1039
6 SASI_Rn02_00215677 predicted 1543
7 SASI_Rn02_00215678 predicted 1757
8 SASI_Rn02_00215679 predicted 1778
9 SASI_Rn02_00215680 predicted 883
10 SASI_Rn02_00215681 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103582 predicted 1306
2 SASI_Mm01_00103583 predicted 997
3 SASI_Mm01_00103584 predicted 776
4 SASI_Mm01_00103585 predicted 1290
5 SASI_Mm01_00103586 predicted 947
6 SASI_Mm01_00103587 predicted 888
7 SASI_Mm01_00103589 predicted 785
8 SASI_Mm01_00103590 predicted 233
9 SASI_Mm02_00313148 predicted 932
10 SASI_Mm02_00313149 predicted 1213
11 SASI_Mm01_00103588 predicted 1150
12 SASI_Mm01_00103591 predicted 1022
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008104
GCM2 MISSION shRNA Bacterial Glycerol Stock
glial cells missing homolog 2 (Drosophila)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008104.1-1724s1c1
Sequence:CCGGCAGCCCTTTAGCTTTGACGATCTCGAGATCGTCAAAGCTAAAGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008104.1-653s1c1
Sequence:CCGGGTCACCAACTTCTGGAGACTTCTCGAGAAGTCTCCAGAAGTTGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008104.1-887s1c1
Sequence:CCGGCTATTTGATATGACTGCTGATCTCGAGATCAGCAGTCATATCAAATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008104.1-1223s1c1
Sequence:CCGGGCTAGGTATCATAGCTGGAAACTCGAGTTTCCAGCTATGATACCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008104.1-2586s1c1
Sequence:CCGGCCTGGCATTTCCACAGATGATCTCGAGATCATCTGTGGAAATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008104.2-1839s21c1
Sequence:CCGGGAACCCTATTCTCGCTCTTAACTCGAGTTAAGAGCGAGAATAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008104.2-1741s21c1
Sequence:CCGGTGCCACACCACATAGGCTATTCTCGAGAATAGCCTATGTGGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008104
GCM2 MISSION shRNA shRNA Plasmid DNA
glial cells missing homolog 2 (Drosophila)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008104.1-1724s1c1
Sequence:CCGGCAGCCCTTTAGCTTTGACGATCTCGAGATCGTCAAAGCTAAAGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008104.1-653s1c1
Sequence:CCGGGTCACCAACTTCTGGAGACTTCTCGAGAAGTCTCCAGAAGTTGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008104.1-887s1c1
Sequence:CCGGCTATTTGATATGACTGCTGATCTCGAGATCAGCAGTCATATCAAATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008104.1-1223s1c1
Sequence:CCGGGCTAGGTATCATAGCTGGAAACTCGAGTTTCCAGCTATGATACCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008104.1-2586s1c1
Sequence:CCGGCCTGGCATTTCCACAGATGATCTCGAGATCATCTGTGGAAATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008104.2-1839s21c1
Sequence:CCGGGAACCCTATTCTCGCTCTTAACTCGAGTTAAGAGCGAGAATAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008104.2-1741s21c1
Sequence:CCGGTGCCACACCACATAGGCTATTCTCGAGAATAGCCTATGTGGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008104
GCM2 MISSION shRNA Lentiviral Transduction Particles
glial cells missing homolog 2 (Drosophila)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008104.1-1724s1c1
Sequence:CCGGCAGCCCTTTAGCTTTGACGATCTCGAGATCGTCAAAGCTAAAGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008104.1-653s1c1
Sequence:CCGGGTCACCAACTTCTGGAGACTTCTCGAGAAGTCTCCAGAAGTTGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008104.1-887s1c1
Sequence:CCGGCTATTTGATATGACTGCTGATCTCGAGATCAGCAGTCATATCAAATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008104.1-1223s1c1
Sequence:CCGGGCTAGGTATCATAGCTGGAAACTCGAGTTTCCAGCTATGATACCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008104.1-2586s1c1
Sequence:CCGGCCTGGCATTTCCACAGATGATCTCGAGATCATCTGTGGAAATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008104.2-1839s21c1
Sequence:CCGGGAACCCTATTCTCGCTCTTAACTCGAGTTAAGAGCGAGAATAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008104.2-1741s21c1
Sequence:CCGGTGCCACACCACATAGGCTATTCTCGAGAATAGCCTATGTGGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004752
GCM2 MISSION shRNA Bacterial Glycerol Stock
glial cells missing homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004752.1-597s1c1
Sequence:CCGGCAAGAGACAAATGGCCTCTTTCTCGAGAAAGAGGCCATTTGTCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004752.1-1144s1c1
Sequence:CCGGCCTTATTATAACCCAGAGCTTCTCGAGAAGCTCTGGGTTATAATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004752.1-712s1c1
Sequence:CCGGCCAGAAGACTTTGATATAGTTCTCGAGAACTATATCAAAGTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004752.1-2199s1c1
Sequence:CCGGCATGATAGTTTCCTAACCTTTCTCGAGAAAGGTTAGGAAACTATCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004752.3-1882s21c1
Sequence:CCGGTAAGTTCACTTAGCTTATTAGCTCGAGCTAATAAGCTAAGTGAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004752.3-856s21c1
Sequence:CCGGTCAAGCCCAAGAATCTATTTGCTCGAGCAAATAGATTCTTGGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004752.3-1854s21c1
Sequence:CCGGGCAAACTGTAGGAGGTTAAATCTCGAGATTTAACCTCCTACAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004752
GCM2 MISSION shRNA shRNA Plasmid DNA
glial cells missing homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004752.1-597s1c1
Sequence:CCGGCAAGAGACAAATGGCCTCTTTCTCGAGAAAGAGGCCATTTGTCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004752.1-1144s1c1
Sequence:CCGGCCTTATTATAACCCAGAGCTTCTCGAGAAGCTCTGGGTTATAATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004752.1-712s1c1
Sequence:CCGGCCAGAAGACTTTGATATAGTTCTCGAGAACTATATCAAAGTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004752.1-2199s1c1
Sequence:CCGGCATGATAGTTTCCTAACCTTTCTCGAGAAAGGTTAGGAAACTATCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004752.3-1882s21c1
Sequence:CCGGTAAGTTCACTTAGCTTATTAGCTCGAGCTAATAAGCTAAGTGAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004752.3-856s21c1
Sequence:CCGGTCAAGCCCAAGAATCTATTTGCTCGAGCAAATAGATTCTTGGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004752.3-1854s21c1
Sequence:CCGGGCAAACTGTAGGAGGTTAAATCTCGAGATTTAACCTCCTACAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004752
GCM2 MISSION shRNA Lentiviral Transduction Particles
glial cells missing homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004752.1-597s1c1
Sequence:CCGGCAAGAGACAAATGGCCTCTTTCTCGAGAAAGAGGCCATTTGTCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004752.1-1144s1c1
Sequence:CCGGCCTTATTATAACCCAGAGCTTCTCGAGAAGCTCTGGGTTATAATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004752.1-712s1c1
Sequence:CCGGCCAGAAGACTTTGATATAGTTCTCGAGAACTATATCAAAGTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004752.1-2199s1c1
Sequence:CCGGCATGATAGTTTCCTAACCTTTCTCGAGAAAGGTTAGGAAACTATCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004752.3-1882s21c1
Sequence:CCGGTAAGTTCACTTAGCTTATTAGCTCGAGCTAATAAGCTAAGTGAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004752.3-856s21c1
Sequence:CCGGTCAAGCCCAAGAATCTATTTGCTCGAGCAAATAGATTCTTGGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004752.3-1854s21c1
Sequence:CCGGGCAAACTGTAGGAGGTTAAATCTCGAGATTTAACCTCCTACAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks