EMAIL THIS PAGE TO A FRIEND

GCN1L1

GCN1 general control of amino-acid synthesis 1-like 1 (yeast)

123 Gene Product Result for
Synonyms: GCN1 GCN1L PRIC295
Gene ID:
Mouse(231659) GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
Rat(690632) GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
Zebrafish(567890) GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
cow(536143) GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
Horse(100053866) GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
domestic cat(101080667) GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
dog(477505) GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
chicken(416982) GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
domestic guinea pig(100726434) GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
naked mole-rat(101703107) GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
sheep(101117194) GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006836 Rosetta Predictions human pricing
XM_001072034 Rosetta Predictions rat pricing
XM_001072108 Rosetta Predictions rat pricing
NM_172719 Rosetta Predictions mouse pricing
XM_358358 Rosetta Predictions mouse pricing
XM_898512 Rosetta Predictions mouse pricing
XM_898519 Rosetta Predictions mouse pricing
XM_898526 Rosetta Predictions mouse pricing
XM_898531 Rosetta Predictions mouse pricing
XM_898535 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018314 predicted 6261
2 SASI_Hs01_00018315 predicted 3938
3 SASI_Hs01_00018316 predicted 4816
4 SASI_Hs01_00018317 predicted 799
5 SASI_Hs01_00018319 predicted 3322
6 SASI_Hs01_00018320 predicted 4706
7 SASI_Hs01_00018321 predicted 5123
8 SASI_Hs01_00018322 predicted 3596
9 SASI_Hs02_00342403 predicted 4278
10 SASI_Hs01_00018323 predicted 8055
11 SASI_Hs01_00018318 predicted 3736
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337504 predicted 7952
2 SASI_Rn02_00337505 predicted 1923
3 SASI_Rn02_00337506 predicted 4964
4 SASI_Rn02_00337507 predicted 4921
5 SASI_Rn02_00337508 predicted 5921
6 SASI_Rn02_00337509 predicted 5178
7 SASI_Rn02_00337510 predicted 4545
8 SASI_Rn02_00337511 predicted 7518
9 SASI_Rn02_00337512 predicted 3733
10 SASI_Rn02_00337513 predicted 7813
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337845 predicted 8006
2 SASI_Rn02_00337846 predicted 1902
3 SASI_Rn02_00337847 predicted 4950
4 SASI_Rn02_00337848 predicted 4907
5 SASI_Rn02_00337849 predicted 3844
6 SASI_Rn02_00337850 predicted 5896
7 SASI_Rn02_00337851 predicted 5165
8 SASI_Rn02_00337852 predicted 4533
9 SASI_Rn02_00337853 predicted 7499
10 SASI_Rn02_00337854 predicted 3720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344512 predicted 1929
2 SASI_Mm02_00344513 predicted 3502
3 SASI_Mm02_00344514 predicted 4974
4 SASI_Mm02_00344515 predicted 6223
5 SASI_Mm02_00344516 predicted 4482
6 SASI_Mm02_00344517 predicted 4912
7 SASI_Mm02_00344518 predicted 4552
8 SASI_Mm02_00344519 predicted 512
9 SASI_Mm02_00344520 predicted 3674
10 SASI_Mm02_00344521 predicted 2388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247188 predicted 1943
2 SASI_Mm01_00247189 predicted 4996
3 SASI_Mm01_00247190 predicted 6237
4 SASI_Mm01_00247191 predicted 4498
5 SASI_Mm01_00247192 predicted 4948
6 SASI_Mm01_00247193 predicted 4924
7 SASI_Mm01_00247194 predicted 4574
8 SASI_Mm01_00247195 predicted 530
9 SASI_Mm01_00247196 predicted 3685
10 SASI_Mm01_00247197 predicted 5795
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217215 predicted 1026
2 SASI_Mm01_00217216 predicted 1276
3 SASI_Mm01_00217217 predicted 1231
4 SASI_Mm01_00217218 predicted 1522
5 SASI_Mm01_00217219 predicted 1071
6 SASI_Mm01_00217220 predicted 2335
7 SASI_Mm01_00217221 predicted 1944
8 SASI_Mm01_00217222 predicted 2173
9 SASI_Mm01_00217223 predicted 1332
10 SASI_Mm01_00217224 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279775 predicted 1944
2 SASI_Mm01_00279776 predicted 3517
3 SASI_Mm01_00279777 predicted 4993
4 SASI_Mm01_00279778 predicted 4500
5 SASI_Mm01_00279779 predicted 4949
6 SASI_Mm01_00279780 predicted 4933
7 SASI_Mm01_00279781 predicted 4568
8 SASI_Mm01_00279782 predicted 530
9 SASI_Mm01_00279783 predicted 3683
10 SASI_Mm01_00279784 predicted 4057
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268763 predicted 726
2 SASI_Mm01_00268764 predicted 939
3 SASI_Mm01_00268765 predicted 1224
4 SASI_Mm01_00268766 predicted 784
5 SASI_Mm01_00268767 predicted 255
6 SASI_Mm01_00268768 predicted 292
7 SASI_Mm01_00268769 predicted 402
8 SASI_Mm01_00268770 predicted 2041
9 SASI_Mm01_00268771 predicted 1645
10 SASI_Mm01_00268772 predicted 1879
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272549 predicted 302
2 SASI_Mm01_00272550 predicted 1547
3 SASI_Mm01_00272551 predicted 1798
4 SASI_Mm01_00272552 predicted 1755
5 SASI_Mm01_00272553 predicted 2035
6 SASI_Mm01_00272554 predicted 251
7 SASI_Mm01_00272555 predicted 235
8 SASI_Mm01_00272556 predicted 760
9 SASI_Mm01_00272557 predicted 1107
10 SASI_Mm01_00272558 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210080 predicted 1943
2 SASI_Mm01_00210081 predicted 4993
3 SASI_Mm01_00210082 predicted 6233
4 SASI_Mm01_00210083 predicted 4503
5 SASI_Mm01_00210084 predicted 4950
6 SASI_Mm01_00210085 predicted 4926
7 SASI_Mm01_00210086 predicted 4570
8 SASI_Mm01_00210087 predicted 535
9 SASI_Mm01_00210088 predicted 3691
10 SASI_Mm01_00210089 predicted 5795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006836
VALIDATED
GCN1L1 MISSION shRNA Bacterial Glycerol Stock
GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-1675s21c1
Sequence:CCGGGCATAGACTCACTGGCAACAACTCGAGTTGTTGCCAGTGAGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-4016s21c1
Sequence:CCGGCCCAAAGTGAAGCCCATTGTTCTCGAGAACAATGGGCTTCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-8304s21c1
Sequence:CCGGGGCTAGGTCTGGAACTATAATCTCGAGATTATAGTTCCAGACCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-177s21c1
Sequence:CCGGGCTTGACTCTGCATCGATATACTCGAGTATATCGATGCAGAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-6005s21c1
Sequence:CCGGGCCGTGCTGTATTTCTCTGAACTCGAGTTCAGAGAAATACAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156203    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006836.1-8278s1c1
Sequence:CCGGCAGGAGCTGTTTGTCCAGTTTCTCGAGAAACTGGACAAACAGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-4016s1c1
Sequence:CCGGCCCAAAGTGAAGCCCATTGTTCTCGAGAACAATGGGCTTCACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-8225s1c1
Sequence:CCGGCCTGTGGAGAAGAGAAGGAAACTCGAGTTTCCTTCTCTTCTCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-6005s1c1
Sequence:CCGGGCCGTGCTGTATTTCTCTGAACTCGAGTTCAGAGAAATACAGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-1675s1c1
Sequence:CCGGGCATAGACTCACTGGCAACAACTCGAGTTGTTGCCAGTGAGTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006836.1-89s1c1
Sequence:CCGGCGGAGAGAAATCCTCAGTGAACTCGAGTTCACTGAGGATTTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-6719s1c1
Sequence:CCGGCACAAGGAAATCCGGCTCATACTCGAGTATGAGCCGGATTTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006836
VALIDATED
GCN1L1 MISSION shRNA shRNA Plasmid DNA
GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-1675s21c1
Sequence:CCGGGCATAGACTCACTGGCAACAACTCGAGTTGTTGCCAGTGAGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-4016s21c1
Sequence:CCGGCCCAAAGTGAAGCCCATTGTTCTCGAGAACAATGGGCTTCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-8304s21c1
Sequence:CCGGGGCTAGGTCTGGAACTATAATCTCGAGATTATAGTTCCAGACCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-177s21c1
Sequence:CCGGGCTTGACTCTGCATCGATATACTCGAGTATATCGATGCAGAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-6005s21c1
Sequence:CCGGGCCGTGCTGTATTTCTCTGAACTCGAGTTCAGAGAAATACAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156203    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006836.1-8278s1c1
Sequence:CCGGCAGGAGCTGTTTGTCCAGTTTCTCGAGAAACTGGACAAACAGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-4016s1c1
Sequence:CCGGCCCAAAGTGAAGCCCATTGTTCTCGAGAACAATGGGCTTCACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-8225s1c1
Sequence:CCGGCCTGTGGAGAAGAGAAGGAAACTCGAGTTTCCTTCTCTTCTCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-6005s1c1
Sequence:CCGGGCCGTGCTGTATTTCTCTGAACTCGAGTTCAGAGAAATACAGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-1675s1c1
Sequence:CCGGGCATAGACTCACTGGCAACAACTCGAGTTGTTGCCAGTGAGTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006836.1-89s1c1
Sequence:CCGGCGGAGAGAAATCCTCAGTGAACTCGAGTTCACTGAGGATTTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-6719s1c1
Sequence:CCGGCACAAGGAAATCCGGCTCATACTCGAGTATGAGCCGGATTTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006836
VALIDATED
GCN1L1 MISSION shRNA Lentiviral Transduction Particles
GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-1675s21c1
Sequence:CCGGGCATAGACTCACTGGCAACAACTCGAGTTGTTGCCAGTGAGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-4016s21c1
Sequence:CCGGCCCAAAGTGAAGCCCATTGTTCTCGAGAACAATGGGCTTCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-8304s21c1
Sequence:CCGGGGCTAGGTCTGGAACTATAATCTCGAGATTATAGTTCCAGACCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-177s21c1
Sequence:CCGGGCTTGACTCTGCATCGATATACTCGAGTATATCGATGCAGAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006836.1-6005s21c1
Sequence:CCGGGCCGTGCTGTATTTCTCTGAACTCGAGTTCAGAGAAATACAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156203    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006836.1-8278s1c1
Sequence:CCGGCAGGAGCTGTTTGTCCAGTTTCTCGAGAAACTGGACAAACAGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-4016s1c1
Sequence:CCGGCCCAAAGTGAAGCCCATTGTTCTCGAGAACAATGGGCTTCACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-8225s1c1
Sequence:CCGGCCTGTGGAGAAGAGAAGGAAACTCGAGTTTCCTTCTCTTCTCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-6005s1c1
Sequence:CCGGGCCGTGCTGTATTTCTCTGAACTCGAGTTCAGAGAAATACAGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-1675s1c1
Sequence:CCGGGCATAGACTCACTGGCAACAACTCGAGTTGTTGCCAGTGAGTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006836.1-89s1c1
Sequence:CCGGCGGAGAGAAATCCTCAGTGAACTCGAGTTCACTGAGGATTTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006836.1-6719s1c1
Sequence:CCGGCACAAGGAAATCCGGCTCATACTCGAGTATGAGCCGGATTTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172719
VALIDATED
GCN1L1 MISSION shRNA Bacterial Glycerol Stock
GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-66s21c1
Sequence:CCGGTTCGCTGTGAAGGTGACAACACTCGAGTGTTGTCACCTTCACAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-167s21c1
Sequence:CCGGGAAAGGGCTCTGCAAGTTGTTCTCGAGAACAACTTGCAGAGCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-391s21c1
Sequence:CCGGTCCTAGTGCGAATTGTCTTTCCTCGAGGAAAGACAATTCGCACTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-190s21c1
Sequence:CCGGGCTTGACACTGCATCGATATACTCGAGTATATCGATGCAGTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-56s21c1
Sequence:CCGGACTGAAGCGCTTCGCTGTGAACTCGAGTTCACAGCGAAGCGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172719
VALIDATED
GCN1L1 MISSION shRNA shRNA Plasmid DNA
GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-66s21c1
Sequence:CCGGTTCGCTGTGAAGGTGACAACACTCGAGTGTTGTCACCTTCACAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-167s21c1
Sequence:CCGGGAAAGGGCTCTGCAAGTTGTTCTCGAGAACAACTTGCAGAGCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-391s21c1
Sequence:CCGGTCCTAGTGCGAATTGTCTTTCCTCGAGGAAAGACAATTCGCACTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-190s21c1
Sequence:CCGGGCTTGACACTGCATCGATATACTCGAGTATATCGATGCAGTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-56s21c1
Sequence:CCGGACTGAAGCGCTTCGCTGTGAACTCGAGTTCACAGCGAAGCGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172719
VALIDATED
GCN1L1 MISSION shRNA Lentiviral Transduction Particles
GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-66s21c1
Sequence:CCGGTTCGCTGTGAAGGTGACAACACTCGAGTGTTGTCACCTTCACAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-167s21c1
Sequence:CCGGGAAAGGGCTCTGCAAGTTGTTCTCGAGAACAACTTGCAGAGCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-391s21c1
Sequence:CCGGTCCTAGTGCGAATTGTCTTTCCTCGAGGAAAGACAATTCGCACTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-190s21c1
Sequence:CCGGGCTTGACACTGCATCGATATACTCGAGTATATCGATGCAGTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172719.2-56s21c1
Sequence:CCGGACTGAAGCGCTTCGCTGTGAACTCGAGTTCACAGCGAAGCGCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks