EMAIL THIS PAGE TO A FRIEND

GCNT1

glucosaminyl (N-acetyl) transferase 1, core 2

Synonyms: C2GNT C2GNT-L C2GNT1 G6NT NACGT2 NAGCT2
UniProtKB ID: Q02742, Q6DJZ4
Gene ID:
Human(2650) Summary: This gene is a member of the beta-1,6-N-acetylglucosaminyltransferase gene family. It is essential to the formation of Gal beta 1-3(GlcNAc beta 1-6)GalNAc structures and the core 2 O-glycan branch. The gene coding this enzyme was originally mapped to 9q21, but was later localized to 9q13. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(14537) glucosaminyl (N-acetyl) transferase 1, core 2
Rat(64043) glucosaminyl (N-acetyl) transferase 1, core 2
sheep(101121316) glucosaminyl (N-acetyl) transferase 1, core 2
Domestic Rabbit(100347030) glucosaminyl (N-acetyl) transferase 1, core 2
domestic guinea pig(100730200) glucosaminyl (N-acetyl) transferase 1, core 2
naked mole-rat(101713056) glucosaminyl (N-acetyl) transferase 1, core 2
chicken(427260) glucosaminyl (N-acetyl) transferase 1, core 2
dog(484158) glucosaminyl (N-acetyl) transferase 1, core 2
domestic cat(101093969) glucosaminyl (N-acetyl) transferase 1, core 2
Horse(100061416) glucosaminyl (N-acetyl) transferase 1, core 2
cow(281778) glucosaminyl (N-acetyl) transferase 1, core 2
178 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001490 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173442 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173442 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173442 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097633 Rosetta Predictions human pricing
NM_001097634 Rosetta Predictions human pricing
NM_001097635 Rosetta Predictions human pricing
NM_001097636 Rosetta Predictions human pricing
NM_001490 Rosetta Predictions human pricing
NM_022276 Rosetta Predictions rat pricing
XM_579453 Rosetta Predictions rat pricing
NM_010265 Rosetta Predictions mouse pricing
NM_173442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318490 predicted 873
2 SASI_Hs02_00318491 predicted 591
3 SASI_Hs02_00318492 predicted 485
4 SASI_Hs02_00318493 predicted 477
5 SASI_Hs02_00318494 predicted 1450
6 SASI_Hs02_00318495 predicted 510
7 SASI_Hs02_00318496 predicted 1115
8 SASI_Hs02_00318497 predicted 813
9 SASI_Hs02_00318498 predicted 1061
10 SASI_Hs02_00318499 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318500 predicted 1374
2 SASI_Hs02_00318501 predicted 1086
3 SASI_Hs02_00318502 predicted 980
4 SASI_Hs02_00318503 predicted 969
5 SASI_Hs02_00318504 predicted 1954
6 SASI_Hs02_00318505 predicted 1011
7 SASI_Hs02_00318506 predicted 1615
8 SASI_Hs02_00318507 predicted 1314
9 SASI_Hs02_00318508 predicted 1556
10 SASI_Hs02_00318509 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318510 predicted 910
2 SASI_Hs02_00318511 predicted 623
3 SASI_Hs02_00318512 predicted 522
4 SASI_Hs02_00318513 predicted 504
5 SASI_Hs02_00318514 predicted 1495
6 SASI_Hs02_00318515 predicted 546
7 SASI_Hs02_00318516 predicted 1151
8 SASI_Hs02_00318517 predicted 852
9 SASI_Hs02_00318518 predicted 1092
10 SASI_Hs02_00318519 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318520 predicted 1001
2 SASI_Hs02_00318521 predicted 715
3 SASI_Hs02_00318522 predicted 615
4 SASI_Hs02_00318523 predicted 606
5 SASI_Hs02_00318524 predicted 1583
6 SASI_Hs02_00318525 predicted 643
7 SASI_Hs02_00318526 predicted 1248
8 SASI_Hs02_00318527 predicted 948
9 SASI_Hs02_00318528 predicted 1190
10 SASI_Hs02_00318529 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127265 predicted 993
2 SASI_Hs01_00127266 predicted 712
3 SASI_Hs01_00127267 predicted 604
4 SASI_Hs01_00127268 predicted 592
5 SASI_Hs01_00127269 predicted 1572
6 SASI_Hs01_00127270 predicted 628
7 SASI_Hs01_00127271 predicted 1237
8 SASI_Hs01_00127272 predicted 935
9 SASI_Hs01_00127273 predicted 1176
10 SASI_Hs01_00127274 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056424 predicted 2009
2 SASI_Rn01_00056425 predicted 1866
3 SASI_Rn01_00056426 predicted 1440
4 SASI_Rn02_00263086 predicted 1736
5 SASI_Rn01_00056427 predicted 1845
6 SASI_Rn01_00056428 predicted 2040
7 SASI_Rn01_00056430 predicted 1814
8 SASI_Rn01_00056431 predicted 2143
9 SASI_Rn01_00056432 predicted 955
10 SASI_Rn01_00056433 predicted 1168
11 SASI_Rn01_00056429 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00195820 predicted 2001
2 SASI_Rn01_00195821 predicted 1862
3 SASI_Rn01_00195822 predicted 1438
4 SASI_Rn01_00195823 predicted 1742
5 SASI_Rn01_00195824 predicted 1853
6 SASI_Rn01_00195825 predicted 2036
7 SASI_Rn01_00195826 predicted 1657
8 SASI_Rn01_00195827 predicted 1818
9 SASI_Rn01_00195828 predicted 1992
10 SASI_Rn01_00195829 predicted 2153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318169 predicted 1732
2 SASI_Mm02_00318170 predicted 959
3 SASI_Mm02_00318171 predicted 783
4 SASI_Mm02_00318172 predicted 990
5 SASI_Mm02_00318173 predicted 775
6 SASI_Mm02_00318174 predicted 1543
7 SASI_Mm02_00318175 predicted 1546
8 SASI_Mm02_00318176 predicted 496
9 SASI_Mm02_00318177 predicted 655
10 SASI_Mm02_00318178 predicted 1385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191272 predicted 1711
2 SASI_Mm01_00191273 predicted 946
3 SASI_Mm01_00191274 predicted 766
4 SASI_Mm01_00191275 predicted 975
5 SASI_Mm02_00345339 predicted 760
6 SASI_Mm01_00191276 predicted 1530
7 SASI_Mm01_00191277 predicted 638
8 SASI_Mm01_00191278 predicted 479
9 SASI_Mm01_00191280 predicted 1368
10 SASI_Mm01_00191281 predicted 986
11 SASI_Mm01_00191279 predicted 1354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001490
VALIDATED
GCNT1 MISSION shRNA Bacterial Glycerol Stock
glucosaminyl (N-acetyl) transferase 1, core 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001490.3-1678s1c1
Sequence:CCGGGCCAATAAGTTTGACGTGGATCTCGAGATCCACGTCAAACTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001490.3-907s1c1
Sequence:CCGGGCCATCTATATGCCTCAGAATCTCGAGATTCTGAGGCATATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001490.3-1023s1c1
Sequence:CCGGCCGATTGGAGAGTGTGGTTTACTCGAGTAAACCACACTCTCCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001490.3-838s1c1
Sequence:CCGGGCGGAGTTTCCAATAGCATATCTCGAGATATGCTATTGGAAACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001490.3-1266s1c1
Sequence:CCGGCGTTAATGGAAAGCTGACAAACTCGAGTTTGTCAGCTTTCCATTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001490.4-2134s21c1
Sequence:CCGGGGGAAGAGGCCGATGCATAAACTCGAGTTTATGCATCGGCCTCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001490.4-868s21c1
Sequence:CCGGTTCATCAAGAGACGCAAATATCTCGAGATATTTGCGTCTCTTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001490.4-2053s21c1
Sequence:CCGGTTAATAGTGGGAGGAGTAAAGCTCGAGCTTTACTCCTCCCACTATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001490.4-1295s21c1
Sequence:CCGGAGAGGATGCCATCCCATAAAGCTCGAGCTTTATGGGATGGCATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001490.4-1795s21c1
Sequence:CCGGCAGTGTTTGGATGAGCATTTGCTCGAGCAAATGCTCATCCAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001490.4-2012s21c1
Sequence:CCGGAGTTAGCTAGAAAGGTGATAGCTCGAGCTATCACCTTTCTAGCTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001490.4-1505s21c1
Sequence:CCGGCATACAGCCCTGATGAGTATCCTCGAGGATACTCATCAGGGCTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001490
VALIDATED
GCNT1 MISSION shRNA shRNA Plasmid DNA
glucosaminyl (N-acetyl) transferase 1, core 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001490.3-1678s1c1
Sequence:CCGGGCCAATAAGTTTGACGTGGATCTCGAGATCCACGTCAAACTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001490.3-907s1c1
Sequence:CCGGGCCATCTATATGCCTCAGAATCTCGAGATTCTGAGGCATATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001490.3-1023s1c1
Sequence:CCGGCCGATTGGAGAGTGTGGTTTACTCGAGTAAACCACACTCTCCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001490.3-838s1c1
Sequence:CCGGGCGGAGTTTCCAATAGCATATCTCGAGATATGCTATTGGAAACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001490.3-1266s1c1
Sequence:CCGGCGTTAATGGAAAGCTGACAAACTCGAGTTTGTCAGCTTTCCATTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001490.4-2134s21c1
Sequence:CCGGGGGAAGAGGCCGATGCATAAACTCGAGTTTATGCATCGGCCTCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001490.4-868s21c1
Sequence:CCGGTTCATCAAGAGACGCAAATATCTCGAGATATTTGCGTCTCTTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001490.4-2053s21c1
Sequence:CCGGTTAATAGTGGGAGGAGTAAAGCTCGAGCTTTACTCCTCCCACTATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001490.4-1295s21c1
Sequence:CCGGAGAGGATGCCATCCCATAAAGCTCGAGCTTTATGGGATGGCATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001490.4-1795s21c1
Sequence:CCGGCAGTGTTTGGATGAGCATTTGCTCGAGCAAATGCTCATCCAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001490.4-2012s21c1
Sequence:CCGGAGTTAGCTAGAAAGGTGATAGCTCGAGCTATCACCTTTCTAGCTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001490.4-1505s21c1
Sequence:CCGGCATACAGCCCTGATGAGTATCCTCGAGGATACTCATCAGGGCTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001490
VALIDATED
GCNT1 MISSION shRNA Lentiviral Transduction Particles
glucosaminyl (N-acetyl) transferase 1, core 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001490.3-1678s1c1
Sequence:CCGGGCCAATAAGTTTGACGTGGATCTCGAGATCCACGTCAAACTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001490.3-907s1c1
Sequence:CCGGGCCATCTATATGCCTCAGAATCTCGAGATTCTGAGGCATATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001490.3-1023s1c1
Sequence:CCGGCCGATTGGAGAGTGTGGTTTACTCGAGTAAACCACACTCTCCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001490.3-838s1c1
Sequence:CCGGGCGGAGTTTCCAATAGCATATCTCGAGATATGCTATTGGAAACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001490.3-1266s1c1
Sequence:CCGGCGTTAATGGAAAGCTGACAAACTCGAGTTTGTCAGCTTTCCATTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001490.4-2134s21c1
Sequence:CCGGGGGAAGAGGCCGATGCATAAACTCGAGTTTATGCATCGGCCTCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001490.4-868s21c1
Sequence:CCGGTTCATCAAGAGACGCAAATATCTCGAGATATTTGCGTCTCTTGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001490.4-2053s21c1
Sequence:CCGGTTAATAGTGGGAGGAGTAAAGCTCGAGCTTTACTCCTCCCACTATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001490.4-1295s21c1
Sequence:CCGGAGAGGATGCCATCCCATAAAGCTCGAGCTTTATGGGATGGCATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001490.4-1795s21c1
Sequence:CCGGCAGTGTTTGGATGAGCATTTGCTCGAGCAAATGCTCATCCAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001490.4-2012s21c1
Sequence:CCGGAGTTAGCTAGAAAGGTGATAGCTCGAGCTATCACCTTTCTAGCTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001490.4-1505s21c1
Sequence:CCGGCATACAGCCCTGATGAGTATCCTCGAGGATACTCATCAGGGCTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173442
GCNT1 MISSION shRNA Bacterial Glycerol Stock
glucosaminyl (N-acetyl) transferase 1, core 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173442.1-988s1c1
Sequence:CCGGGTGGTATGGATTTCCCTATTACTCGAGTAATAGGGAAATCCATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173442.1-3267s1c1
Sequence:CCGGCCCTCTATACTGGCTTCTGATCTCGAGATCAGAAGCCAGTATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173442.1-1533s1c1
Sequence:CCGGGCCAATAAGTTTGACATGGATCTCGAGATCCATGTCAAACTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173442.1-878s1c1
Sequence:CCGGCCAGTTGGAGAGTGTTGTTTACTCGAGTAAACAACACTCTCCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173442.1-763s1c1
Sequence:CCGGCCATCTATATGCCTCAGAATTCTCGAGAATTCTGAGGCATATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173442
GCNT1 MISSION shRNA shRNA Plasmid DNA
glucosaminyl (N-acetyl) transferase 1, core 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173442.1-988s1c1
Sequence:CCGGGTGGTATGGATTTCCCTATTACTCGAGTAATAGGGAAATCCATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173442.1-3267s1c1
Sequence:CCGGCCCTCTATACTGGCTTCTGATCTCGAGATCAGAAGCCAGTATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173442.1-1533s1c1
Sequence:CCGGGCCAATAAGTTTGACATGGATCTCGAGATCCATGTCAAACTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173442.1-878s1c1
Sequence:CCGGCCAGTTGGAGAGTGTTGTTTACTCGAGTAAACAACACTCTCCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173442.1-763s1c1
Sequence:CCGGCCATCTATATGCCTCAGAATTCTCGAGAATTCTGAGGCATATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173442
GCNT1 MISSION shRNA Lentiviral Transduction Particles
glucosaminyl (N-acetyl) transferase 1, core 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173442.1-988s1c1
Sequence:CCGGGTGGTATGGATTTCCCTATTACTCGAGTAATAGGGAAATCCATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173442.1-3267s1c1
Sequence:CCGGCCCTCTATACTGGCTTCTGATCTCGAGATCAGAAGCCAGTATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173442.1-1533s1c1
Sequence:CCGGGCCAATAAGTTTGACATGGATCTCGAGATCCATGTCAAACTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173442.1-878s1c1
Sequence:CCGGCCAGTTGGAGAGTGTTGTTTACTCGAGTAAACAACACTCTCCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173442.1-763s1c1
Sequence:CCGGCCATCTATATGCCTCAGAATTCTCGAGAATTCTGAGGCATATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks