EMAIL THIS PAGE TO A FRIEND

GCNT2

glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)

199 Gene Product Result for
Synonyms: CCAT CTRCT13 GCNT2C GCNT5 IGNT II NACGT1 NAGCT1 ULG3 bA360O19.2 bA421M1.1
UniProtKB ID: Q8NFS9, Q5T4J1, Q6T5E5
Gene ID:
Human(2651) Summary: This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(14538) glucosaminyl (N-acetyl) transferase 2, I-branching enzyme
Rat(306860) glucosaminyl (N-acetyl) transferase 2, I-branching enzyme
chicken(420861) glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
dog(488215) glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
cow(520336) glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
cow(613924) glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
Horse(100063291) glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
naked mole-rat(101702179) glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
Goat(100861326) glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008105 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008105 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008105 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145649 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088911 MISSION® esiRNA esiRNA human GCNT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001491 Rosetta Predictions human pricing
NM_145649 Rosetta Predictions human pricing
NM_145655 Rosetta Predictions human pricing
NM_001001511 Rosetta Predictions rat pricing
XM_577565 Rosetta Predictions rat pricing
NM_008105 Rosetta Predictions mouse pricing
NM_023887 Rosetta Predictions mouse pricing
NM_133219 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104132 predicted 1923
2 SASI_Hs01_00104133 predicted 2192
3 SASI_Hs01_00104134 predicted 1873
4 SASI_Hs01_00104135 predicted 2342
5 SASI_Hs01_00104136 predicted 2080
6 SASI_Hs01_00104137 predicted 1882
7 SASI_Hs02_00331975 predicted 2030
8 SASI_Hs01_00104138 predicted 2352
9 SASI_Hs01_00104139 predicted 2252
10 SASI_Hs01_00104140 predicted 2288
11 SASI_Hs01_00104131 predicted 1911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145984 predicted 1646
2 SASI_Hs01_00145985 predicted 1929
3 SASI_Hs01_00145986 predicted 1599
4 SASI_Hs01_00145987 predicted 2076
5 SASI_Hs01_00145988 predicted 1812
6 SASI_Hs01_00145989 predicted 1617
7 SASI_Hs02_00365268 predicted 1768
8 SASI_Hs01_00145990 predicted 2083
9 SASI_Hs01_00145991 predicted 1984
10 SASI_Hs01_00145992 predicted 2017
11 SASI_Hs01_00145983 predicted 1647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087371 predicted 1444
2 SASI_Hs01_00087372 predicted 1722
3 SASI_Hs01_00087373 predicted 1399
4 SASI_Hs01_00087374 predicted 1869
5 SASI_Hs01_00087375 predicted 1609
6 SASI_Hs01_00087376 predicted 1412
7 SASI_Hs02_00365280 predicted 1562
8 SASI_Hs01_00087377 predicted 1877
9 SASI_Hs01_00087378 predicted 1783
10 SASI_Hs01_00087379 predicted 1818
11 SASI_Hs01_00087370 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055849 predicted 1349
2 SASI_Rn01_00055850 predicted 1331
3 SASI_Rn01_00055851 predicted 575
4 SASI_Rn01_00055853 predicted 1176
5 SASI_Rn01_00055854 predicted 1166
6 SASI_Rn02_00197911 predicted 880
7 SASI_Rn01_00055855 predicted 1492
8 SASI_Rn01_00055856 predicted 1136
9 SASI_Rn01_00055857 predicted 740
10 SASI_Rn01_00055858 predicted 1629
11 SASI_Rn01_00055852 predicted 1563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146227 predicted 302
2 SASI_Rn01_00146228 predicted 751
3 SASI_Rn01_00146229 predicted 732
4 SASI_Rn01_00146230 predicted 681
5 SASI_Rn01_00146231 predicted 273
6 SASI_Rn01_00146232 predicted 721
7 SASI_Rn01_00146233 predicted 291
8 SASI_Rn01_00146234 predicted 276
9 SASI_Rn01_00146235 predicted 721
10 SASI_Rn01_00146236 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044893 predicted 1887
2 SASI_Mm01_00044894 predicted 1374
3 SASI_Mm01_00044895 predicted 1355
4 SASI_Mm01_00044896 predicted 1316
5 SASI_Mm01_00044897 predicted 373
6 SASI_Mm01_00044898 predicted 786
7 SASI_Mm02_00313150 predicted 1231
8 SASI_Mm01_00044899 predicted 1088
9 SASI_Mm01_00044901 predicted 1068
10 SASI_Mm01_00044902 predicted 1009
11 SASI_Mm01_00044900 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163055 predicted 1903
2 SASI_Mm01_00163056 predicted 1401
3 SASI_Mm01_00163057 predicted 1376
4 SASI_Mm01_00163058 predicted 1331
5 SASI_Mm01_00163059 predicted 509
6 SASI_Mm01_00163060 predicted 811
7 SASI_Mm01_00163061 predicted 1088
8 SASI_Mm01_00163062 predicted 948
9 SASI_Mm01_00163063 predicted 277
10 SASI_Mm01_00163064 predicted 1253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049312 predicted 1930
2 SASI_Mm01_00049313 predicted 1428
3 SASI_Mm01_00049314 predicted 1399
4 SASI_Mm01_00049315 predicted 421
5 SASI_Mm01_00049316 predicted 1358
6 SASI_Mm01_00049317 predicted 1121
7 SASI_Mm01_00049318 predicted 1114
8 SASI_Mm01_00049319 predicted 1272
9 SASI_Mm01_00049320 predicted 836
10 SASI_Mm01_00049321 predicted 909
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008105
VALIDATED
GCNT2 MISSION shRNA Bacterial Glycerol Stock
glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008105.2-700s1c1
Sequence:CCGGGCTGACCTGAACTGCATCAAACTCGAGTTTGATGCAGTTCAGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008105.2-2678s1c1
Sequence:CCGGGCCTCTTGAATGTCTATGATTCTCGAGAATCATAGACATTCAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008105.2-375s1c1
Sequence:CCGGCCTGTGGAGAAACAAACTAATCTCGAGATTAGTTTGTTTCTCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008105.2-416s1c1
Sequence:CCGGGCACAGAATATGTGACCCAAACTCGAGTTTGGGTCACATATTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008105.2-1347s1c1
Sequence:CCGGGCTTCGAGAAAGAACACTCAACTCGAGTTGAGTGTTCTTTCTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008105
VALIDATED
GCNT2 MISSION shRNA shRNA Plasmid DNA
glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008105.2-700s1c1
Sequence:CCGGGCTGACCTGAACTGCATCAAACTCGAGTTTGATGCAGTTCAGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008105.2-2678s1c1
Sequence:CCGGGCCTCTTGAATGTCTATGATTCTCGAGAATCATAGACATTCAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008105.2-375s1c1
Sequence:CCGGCCTGTGGAGAAACAAACTAATCTCGAGATTAGTTTGTTTCTCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008105.2-416s1c1
Sequence:CCGGGCACAGAATATGTGACCCAAACTCGAGTTTGGGTCACATATTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008105.2-1347s1c1
Sequence:CCGGGCTTCGAGAAAGAACACTCAACTCGAGTTGAGTGTTCTTTCTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008105
VALIDATED
GCNT2 MISSION shRNA Lentiviral Transduction Particles
glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008105.2-700s1c1
Sequence:CCGGGCTGACCTGAACTGCATCAAACTCGAGTTTGATGCAGTTCAGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008105.2-2678s1c1
Sequence:CCGGGCCTCTTGAATGTCTATGATTCTCGAGAATCATAGACATTCAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008105.2-375s1c1
Sequence:CCGGCCTGTGGAGAAACAAACTAATCTCGAGATTAGTTTGTTTCTCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008105.2-416s1c1
Sequence:CCGGGCACAGAATATGTGACCCAAACTCGAGTTTGGGTCACATATTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008105.2-1347s1c1
Sequence:CCGGGCTTCGAGAAAGAACACTCAACTCGAGTTGAGTGTTCTTTCTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145649
VALIDATED
GCNT2 MISSION shRNA Bacterial Glycerol Stock
glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-794s1c1
Sequence:CCGGCGAAGCCACTATGTAACAGAACTCGAGTTCTGTTACATAGTGGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-865s1c1
Sequence:CCGGCCACAAAGACTTCGGCACTTTCTCGAGAAAGTGCCGAAGTCTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-1649s1c1
Sequence:CCGGGCTAACAAGTTTGAGCTTAATCTCGAGATTAAGCTCAAACTTGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-1575s1c1
Sequence:CCGGGCCACTATGTACATGGTATTTCTCGAGAAATACCATGTACATAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-2003s1c1
Sequence:CCGGGCTCACCTCTATATTAGTTTACTCGAGTAAACTAATATAGAGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145649
VALIDATED
GCNT2 MISSION shRNA shRNA Plasmid DNA
glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-794s1c1
Sequence:CCGGCGAAGCCACTATGTAACAGAACTCGAGTTCTGTTACATAGTGGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-865s1c1
Sequence:CCGGCCACAAAGACTTCGGCACTTTCTCGAGAAAGTGCCGAAGTCTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-1649s1c1
Sequence:CCGGGCTAACAAGTTTGAGCTTAATCTCGAGATTAAGCTCAAACTTGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-1575s1c1
Sequence:CCGGGCCACTATGTACATGGTATTTCTCGAGAAATACCATGTACATAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-2003s1c1
Sequence:CCGGGCTCACCTCTATATTAGTTTACTCGAGTAAACTAATATAGAGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145649
VALIDATED
GCNT2 MISSION shRNA Lentiviral Transduction Particles
glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-794s1c1
Sequence:CCGGCGAAGCCACTATGTAACAGAACTCGAGTTCTGTTACATAGTGGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-865s1c1
Sequence:CCGGCCACAAAGACTTCGGCACTTTCTCGAGAAAGTGCCGAAGTCTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-1649s1c1
Sequence:CCGGGCTAACAAGTTTGAGCTTAATCTCGAGATTAAGCTCAAACTTGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-1575s1c1
Sequence:CCGGGCCACTATGTACATGGTATTTCTCGAGAAATACCATGTACATAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_145649.2-2003s1c1
Sequence:CCGGGCTCACCTCTATATTAGTTTACTCGAGTAAACTAATATAGAGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks