EMAIL THIS PAGE TO A FRIEND

GCNT3

glucosaminyl (N-acetyl) transferase 3, mucin type

57 Gene Product Result for
Synonyms: C2/4GnT C24GNT C2GNT2 C2GNTM GNTM
UniProtKB ID: O95395
Gene ID:
Human(9245) Summary: This gene encodes a member of the N-acetylglucosaminyltransferase family. The encoded protein is a beta-6-N-acetylglucosamine-transferase that catalyzes the formation of core 2 and core 4 O-glycans on mucin-type glycoproteins.[provided by RefSeq, Apr 2009]
Mouse(72077) glucosaminyl (N-acetyl) transferase 3, mucin type
Rat(286976) glucosaminyl (N-acetyl) transferase 3, mucin type
sheep(101114706) glucosaminyl (N-acetyl) transferase 3, mucin type
Domestic Rabbit(100356389) glucosaminyl (N-acetyl) transferase 3, mucin type
domestic guinea pig(100724625) glucosaminyl (N-acetyl) transferase 3, mucin type
naked mole-rat(101725838) glucosaminyl (N-acetyl) transferase 3, mucin type
Zebrafish(100332076) glucosaminyl (N-acetyl) transferase 3, mucin type
dog(487578) glucosaminyl (N-acetyl) transferase 3, mucin type
cow(404167) glucosaminyl (N-acetyl) transferase 3, mucin type
domestic cat(101101139) glucosaminyl (N-acetyl) transferase 3, mucin type
chicken(427492) glucosaminyl (N-acetyl) transferase 3, mucin type
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004751 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004751 Rosetta Predictions human pricing
NM_173312 Rosetta Predictions rat pricing
NM_028087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011728 predicted 1572
2 SASI_Hs01_00011729 predicted 751
3 SASI_Hs01_00011730 predicted 1451
4 SASI_Hs01_00011731 predicted 894
5 SASI_Hs01_00011732 predicted 1142
6 SASI_Hs01_00011733 predicted 1464
7 SASI_Hs01_00011734 predicted 1759
8 SASI_Hs01_00011735 predicted 1644
9 SASI_Hs02_00338236 predicted 1012
10 SASI_Hs01_00011736 predicted 1296
11 SASI_Hs01_00011737 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269410 predicted 398
2 SASI_Rn01_00119965 predicted 1437
3 SASI_Rn01_00119966 predicted 263
4 SASI_Rn01_00119967 predicted 1376
5 SASI_Rn01_00119968 predicted 1162
6 SASI_Rn02_00269411 predicted 1267
7 SASI_Rn01_00119970 predicted 1500
8 SASI_Rn01_00119971 predicted 307
9 SASI_Rn01_00119973 predicted 782
10 SASI_Rn01_00119974 predicted 764
11 SASI_Rn01_00119969 predicted 1138
12 SASI_Rn01_00119972 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083985 predicted 1730
2 SASI_Mm01_00083986 predicted 1452
3 SASI_Mm01_00083987 predicted 1705
4 SASI_Mm01_00083988 predicted 1235
5 SASI_Mm01_00083989 predicted 1360
6 SASI_Mm01_00083990 predicted 1002
7 SASI_Mm01_00083991 predicted 1000
8 SASI_Mm02_00333324 predicted 1763
9 SASI_Mm02_00333325 predicted 1160
10 SASI_Mm01_00083992 predicted 1799
11 SASI_Mm01_00083993 predicted 687
12 SASI_Mm01_00083994 predicted 1191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028087
GCNT3 MISSION shRNA Bacterial Glycerol Stock
glucosaminyl (N-acetyl) transferase 3, mucin type
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028087.1-1651s1c1
Sequence:CCGGGCAGAGCTAGAACATGAAATACTCGAGTATTTCATGTTCTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028087.1-986s1c1
Sequence:CCGGCCTAACCATGTTCACTGGGAACTCGAGTTCCCAGTGAACATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028087.1-974s1c1
Sequence:CCGGGCCACCTAATAACCTAACCATCTCGAGATGGTTAGGTTATTAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028087.1-455s1c1
Sequence:CCGGGCACTTCAAGACCAAGAGGAACTCGAGTTCCTCTTGGTCTTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028087.1-375s1c1
Sequence:CCGGCTGCTGAATAACCTGGAAATTCTCGAGAATTTCCAGGTTATTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028087
GCNT3 MISSION shRNA shRNA Plasmid DNA
glucosaminyl (N-acetyl) transferase 3, mucin type
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028087.1-1651s1c1
Sequence:CCGGGCAGAGCTAGAACATGAAATACTCGAGTATTTCATGTTCTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028087.1-986s1c1
Sequence:CCGGCCTAACCATGTTCACTGGGAACTCGAGTTCCCAGTGAACATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028087.1-974s1c1
Sequence:CCGGGCCACCTAATAACCTAACCATCTCGAGATGGTTAGGTTATTAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028087.1-455s1c1
Sequence:CCGGGCACTTCAAGACCAAGAGGAACTCGAGTTCCTCTTGGTCTTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028087.1-375s1c1
Sequence:CCGGCTGCTGAATAACCTGGAAATTCTCGAGAATTTCCAGGTTATTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028087
GCNT3 MISSION shRNA Lentiviral Transduction Particles
glucosaminyl (N-acetyl) transferase 3, mucin type
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028087.1-1651s1c1
Sequence:CCGGGCAGAGCTAGAACATGAAATACTCGAGTATTTCATGTTCTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028087.1-986s1c1
Sequence:CCGGCCTAACCATGTTCACTGGGAACTCGAGTTCCCAGTGAACATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028087.1-974s1c1
Sequence:CCGGGCCACCTAATAACCTAACCATCTCGAGATGGTTAGGTTATTAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028087.1-455s1c1
Sequence:CCGGGCACTTCAAGACCAAGAGGAACTCGAGTTCCTCTTGGTCTTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028087.1-375s1c1
Sequence:CCGGCTGCTGAATAACCTGGAAATTCTCGAGAATTTCCAGGTTATTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004751
VALIDATED
GCNT3 MISSION shRNA Bacterial Glycerol Stock
glucosaminyl (N-acetyl) transferase 3, mucin type
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004751.1-1796s1c1
Sequence:CCGGGCTGCTATTAGATTGTGGGTACTCGAGTACCCACAATCTAATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004751.1-1621s1c1
Sequence:CCGGGCTTAGAAGAATACCTACGTTCTCGAGAACGTAGGTATTCTTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004751.1-1590s1c1
Sequence:CCGGGACCCAAAGGTAGATGATAATCTCGAGATTATCATCTACCTTTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004751.1-1412s1c1
Sequence:CCGGCATCTCAGACATGACTTCTATCTCGAGATAGAAGTCATGTCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004751.1-500s1c1
Sequence:CCGGCCAGTACTGTAGGAATATCTTCTCGAGAAGATATTCCTACAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004751.1-753s1c1
Sequence:CCGGGCATACTCTATGGTGATTCATCTCGAGATGAATCACCATAGAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004751.1-1590s21c1
Sequence:CCGGGACCCAAAGGTAGATGATAATCTCGAGATTATCATCTACCTTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004751.1-753s21c1
Sequence:CCGGGCATACTCTATGGTGATTCATCTCGAGATGAATCACCATAGAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004751.1-1621s21c1
Sequence:CCGGGCTTAGAAGAATACCTACGTTCTCGAGAACGTAGGTATTCTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004751.1-500s21c1
Sequence:CCGGCCAGTACTGTAGGAATATCTTCTCGAGAAGATATTCCTACAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_004751.1-1796s21c1
Sequence:CCGGGCTGCTATTAGATTGTGGGTACTCGAGTACCCACAATCTAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004751
VALIDATED
GCNT3 MISSION shRNA shRNA Plasmid DNA
glucosaminyl (N-acetyl) transferase 3, mucin type
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004751.1-1796s1c1
Sequence:CCGGGCTGCTATTAGATTGTGGGTACTCGAGTACCCACAATCTAATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004751.1-1621s1c1
Sequence:CCGGGCTTAGAAGAATACCTACGTTCTCGAGAACGTAGGTATTCTTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004751.1-1590s1c1
Sequence:CCGGGACCCAAAGGTAGATGATAATCTCGAGATTATCATCTACCTTTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004751.1-1412s1c1
Sequence:CCGGCATCTCAGACATGACTTCTATCTCGAGATAGAAGTCATGTCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004751.1-500s1c1
Sequence:CCGGCCAGTACTGTAGGAATATCTTCTCGAGAAGATATTCCTACAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004751.1-753s1c1
Sequence:CCGGGCATACTCTATGGTGATTCATCTCGAGATGAATCACCATAGAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004751.1-1590s21c1
Sequence:CCGGGACCCAAAGGTAGATGATAATCTCGAGATTATCATCTACCTTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004751.1-753s21c1
Sequence:CCGGGCATACTCTATGGTGATTCATCTCGAGATGAATCACCATAGAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004751.1-1621s21c1
Sequence:CCGGGCTTAGAAGAATACCTACGTTCTCGAGAACGTAGGTATTCTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004751.1-500s21c1
Sequence:CCGGCCAGTACTGTAGGAATATCTTCTCGAGAAGATATTCCTACAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_004751.1-1796s21c1
Sequence:CCGGGCTGCTATTAGATTGTGGGTACTCGAGTACCCACAATCTAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004751
VALIDATED
GCNT3 MISSION shRNA Lentiviral Transduction Particles
glucosaminyl (N-acetyl) transferase 3, mucin type
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004751.1-1796s1c1
Sequence:CCGGGCTGCTATTAGATTGTGGGTACTCGAGTACCCACAATCTAATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004751.1-1621s1c1
Sequence:CCGGGCTTAGAAGAATACCTACGTTCTCGAGAACGTAGGTATTCTTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004751.1-1590s1c1
Sequence:CCGGGACCCAAAGGTAGATGATAATCTCGAGATTATCATCTACCTTTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004751.1-1412s1c1
Sequence:CCGGCATCTCAGACATGACTTCTATCTCGAGATAGAAGTCATGTCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004751.1-500s1c1
Sequence:CCGGCCAGTACTGTAGGAATATCTTCTCGAGAAGATATTCCTACAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004751.1-753s1c1
Sequence:CCGGGCATACTCTATGGTGATTCATCTCGAGATGAATCACCATAGAGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004751.1-1590s21c1
Sequence:CCGGGACCCAAAGGTAGATGATAATCTCGAGATTATCATCTACCTTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004751.1-753s21c1
Sequence:CCGGGCATACTCTATGGTGATTCATCTCGAGATGAATCACCATAGAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004751.1-1621s21c1
Sequence:CCGGGCTTAGAAGAATACCTACGTTCTCGAGAACGTAGGTATTCTTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004751.1-500s21c1
Sequence:CCGGCCAGTACTGTAGGAATATCTTCTCGAGAAGATATTCCTACAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_004751.1-1796s21c1
Sequence:CCGGGCTGCTATTAGATTGTGGGTACTCGAGTACCCACAATCTAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks