EMAIL THIS PAGE TO A FRIEND

GCNT4

glucosaminyl (N-acetyl) transferase 4, core 2

84 Gene Product Result for
Synonyms: C2GNT3
UniProtKB ID: Q9P109
Gene ID:
Mouse(218476) glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)
Rat(310011) glucosaminyl (N-acetyl) transferase 4, core 2
chicken(427207) glucosaminyl (N-acetyl) transferase 4, core 2
domestic cat(101081604) glucosaminyl (N-acetyl) transferase 4, core 2
dog(488946) glucosaminyl (N-acetyl) transferase 4, core 2
cow(782825) glucosaminyl (N-acetyl) transferase 4, core 2
naked mole-rat(101713732) glucosaminyl (N-acetyl) transferase 4, core 2
domestic guinea pig(100728182) glucosaminyl (N-acetyl) transferase 4, core 2
sheep(101104496) glucosaminyl (N-acetyl) transferase 4, core 2
Domestic Rabbit(100358309) glucosaminyl (N-acetyl) transferase 4, core 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016591 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000921 MISSION® esiRNA esiRNA targeting human GCNT4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016591 Rosetta Predictions human pricing
XM_001069016 Rosetta Predictions rat pricing
XM_226703 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231092 predicted 941
2 SASI_Hs01_00231093 predicted 1338
3 SASI_Hs01_00231094 predicted 1280
4 SASI_Hs01_00231095 predicted 1029
5 SASI_Hs01_00231096 predicted 1351
6 SASI_Hs01_00231097 predicted 2197
7 SASI_Hs01_00231098 predicted 1066
8 SASI_Hs01_00231099 predicted 1286
9 SASI_Hs01_00231100 predicted 1162
10 SASI_Hs02_00349724 predicted 983
11 SASI_Hs01_00231091 predicted 2237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326608 predicted 523
2 SASI_Rn02_00326609 predicted 989
3 SASI_Rn02_00326610 predicted 1090
4 SASI_Rn02_00326611 predicted 1110
5 SASI_Rn02_00326612 predicted 539
6 SASI_Rn02_00326613 predicted 436
7 SASI_Rn02_00326614 predicted 343
8 SASI_Rn02_00326615 predicted 711
9 SASI_Rn02_00326616 predicted 260
10 SASI_Rn02_00326617 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383785 predicted 811
2 SASI_Rn02_00383786 predicted 1274
3 SASI_Rn02_00383787 predicted 1374
4 SASI_Rn02_00383788 predicted 1398
5 SASI_Rn02_00383789 predicted 821
6 SASI_Rn02_00383790 predicted 725
7 SASI_Rn02_00383791 predicted 627
8 SASI_Rn02_00383792 predicted 997
9 SASI_Rn02_00383793 predicted 545
10 SASI_Rn02_00383794 predicted 1399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016591
GCNT4 MISSION shRNA Bacterial Glycerol Stock
glucosaminyl (N-acetyl) transferase 4, core 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016591.1-2786s1c1
Sequence:CCGGGCCAAAGCATAATCTGCCTTTCTCGAGAAAGGCAGATTATGCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184889    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016591.1-2924s1c1
Sequence:CCGGCGAAGGGATTTATACAACATTCTCGAGAATGTTGTATAAATCCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186348    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016591.1-2639s1c1
Sequence:CCGGCCCATTTCAGAGTAGTGTTTACTCGAGTAAACACTACTCTGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016591.1-1701s1c1
Sequence:CCGGGCTACCAATAAGGACAAACATCTCGAGATGTTTGTCCTTATTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016591.1-1326s1c1
Sequence:CCGGCCAGCACAATATTTACTGCATCTCGAGATGCAGTAAATATTGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016591.1-1250s1c1
Sequence:CCGGGCTTCCCAATAGCCTATTCTTCTCGAGAAGAATAGGCTATTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016591
GCNT4 MISSION shRNA shRNA Plasmid DNA
glucosaminyl (N-acetyl) transferase 4, core 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016591.1-2786s1c1
Sequence:CCGGGCCAAAGCATAATCTGCCTTTCTCGAGAAAGGCAGATTATGCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184889    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016591.1-2924s1c1
Sequence:CCGGCGAAGGGATTTATACAACATTCTCGAGAATGTTGTATAAATCCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186348    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016591.1-2639s1c1
Sequence:CCGGCCCATTTCAGAGTAGTGTTTACTCGAGTAAACACTACTCTGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016591.1-1701s1c1
Sequence:CCGGGCTACCAATAAGGACAAACATCTCGAGATGTTTGTCCTTATTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016591.1-1326s1c1
Sequence:CCGGCCAGCACAATATTTACTGCATCTCGAGATGCAGTAAATATTGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016591.1-1250s1c1
Sequence:CCGGGCTTCCCAATAGCCTATTCTTCTCGAGAAGAATAGGCTATTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016591
GCNT4 MISSION shRNA Lentiviral Transduction Particles
glucosaminyl (N-acetyl) transferase 4, core 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016591.1-2786s1c1
Sequence:CCGGGCCAAAGCATAATCTGCCTTTCTCGAGAAAGGCAGATTATGCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184889    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016591.1-2924s1c1
Sequence:CCGGCGAAGGGATTTATACAACATTCTCGAGAATGTTGTATAAATCCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186348    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016591.1-2639s1c1
Sequence:CCGGCCCATTTCAGAGTAGTGTTTACTCGAGTAAACACTACTCTGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016591.1-1701s1c1
Sequence:CCGGGCTACCAATAAGGACAAACATCTCGAGATGTTTGTCCTTATTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016591.1-1326s1c1
Sequence:CCGGCCAGCACAATATTTACTGCATCTCGAGATGCAGTAAATATTGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016591.1-1250s1c1
Sequence:CCGGGCTTCCCAATAGCCTATTCTTCTCGAGAAGAATAGGCTATTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks