EMAIL THIS PAGE TO A FRIEND

GCNT7

glucosaminyl (N-acetyl) transferase family member 7

24 Gene Product Result for
Synonyms: C20orf105 dJ1153D9.2 gcnt
UniProtKB ID: Q6ZNI0, Q9HCV8
Gene ID:
Mouse(654821) glucosaminyl (N-acetyl) transferase family member 7
Rat(100359842) glucosaminyl (N-acetyl) transferase family member 7
chicken(769120) glucosaminyl (N-acetyl) transferase family member 7
Horse(100146488) glucosaminyl (N-acetyl) transferase family member 7
cow(100138125) glucosaminyl (N-acetyl) transferase family member 7
domestic cat(101090681) glucosaminyl (N-acetyl) transferase family member 7
sheep(101119068) glucosaminyl (N-acetyl) transferase family member 7
Domestic Rabbit(100348856) glucosaminyl (N-acetyl) transferase family member 7
domestic guinea pig(100726086) glucosaminyl (N-acetyl) transferase family member 7
naked mole-rat(101710131) glucosaminyl (N-acetyl) transferase family member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080615 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104219 predicted 559
2 SASI_Mm01_00104220 predicted 989
3 SASI_Mm01_00104221 predicted 572
4 SASI_Mm02_00290155 predicted 319
5 SASI_Mm01_00104222 predicted 942
6 SASI_Mm02_00290156 predicted 1176
7 SASI_Mm01_00104224 predicted 621
8 SASI_Mm02_00290157 predicted 492
9 SASI_Mm01_00104225 predicted 1020
10 SASI_Mm01_00104227 predicted 760
11 SASI_Mm01_00104223 predicted 324
12 SASI_Mm01_00104226 predicted 343
13 SASI_Mm01_00104228 predicted 1550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080615
GCNT7 MISSION shRNA Bacterial Glycerol Stock
glucosaminyl (N-acetyl) transferase family member 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-856s21c1
Sequence:CCGGTGAACTGTGTTCCGCTTTATTCTCGAGAATAAAGCGGAACACAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-1780s21c1
Sequence:CCGGCGTCGAAGACATCTGCGTATACTCGAGTATACGCAGATGTCTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-1654s21c1
Sequence:CCGGGGTGACCCTGAACCGACTAAACTCGAGTTTAGTCGGTTCAGGGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-1242s21c1
Sequence:CCGGCAAGACTACAGGCAGATATTACTCGAGTAATATCTGCCTGTAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-1027s21c1
Sequence:CCGGCGATTTCTCTTTGGCATATATCTCGAGATATATGCCAAAGAGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080615
GCNT7 MISSION shRNA shRNA Plasmid DNA
glucosaminyl (N-acetyl) transferase family member 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-856s21c1
Sequence:CCGGTGAACTGTGTTCCGCTTTATTCTCGAGAATAAAGCGGAACACAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-1780s21c1
Sequence:CCGGCGTCGAAGACATCTGCGTATACTCGAGTATACGCAGATGTCTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-1654s21c1
Sequence:CCGGGGTGACCCTGAACCGACTAAACTCGAGTTTAGTCGGTTCAGGGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-1242s21c1
Sequence:CCGGCAAGACTACAGGCAGATATTACTCGAGTAATATCTGCCTGTAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-1027s21c1
Sequence:CCGGCGATTTCTCTTTGGCATATATCTCGAGATATATGCCAAAGAGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080615
GCNT7 MISSION shRNA Lentiviral Transduction Particles
glucosaminyl (N-acetyl) transferase family member 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-856s21c1
Sequence:CCGGTGAACTGTGTTCCGCTTTATTCTCGAGAATAAAGCGGAACACAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-1780s21c1
Sequence:CCGGCGTCGAAGACATCTGCGTATACTCGAGTATACGCAGATGTCTTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-1654s21c1
Sequence:CCGGGGTGACCCTGAACCGACTAAACTCGAGTTTAGTCGGTTCAGGGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-1242s21c1
Sequence:CCGGCAAGACTACAGGCAGATATTACTCGAGTAATATCTGCCTGTAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080615.1-1027s21c1
Sequence:CCGGCGATTTCTCTTTGGCATATATCTCGAGATATATGCCAAAGAGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039560
GCNT7 MISSION shRNA Bacterial Glycerol Stock
glucosaminyl (N-acetyl) transferase family member 7
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000262557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039560.3-554s21c1
Sequence:CCGGGCGGCTTCTCAGAGCGATTTACTCGAGTAAATCGCTCTGAGAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039560.3-1726s21c1
Sequence:CCGGTGAGTAAGAGGCGCATATATACTCGAGTATATATGCGCCTCTTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039560.3-328s21c1
Sequence:CCGGATGAACTGTGCTCGGCTTTATCTCGAGATAAAGCCGAGCACAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039560.3-1450s21c1
Sequence:CCGGACAGTCAACCTCACCATTAAGCTCGAGCTTAATGGTGAGGTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039560
GCNT7 MISSION shRNA shRNA Plasmid DNA
glucosaminyl (N-acetyl) transferase family member 7
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000262557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039560.3-554s21c1
Sequence:CCGGGCGGCTTCTCAGAGCGATTTACTCGAGTAAATCGCTCTGAGAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039560.3-1726s21c1
Sequence:CCGGTGAGTAAGAGGCGCATATATACTCGAGTATATATGCGCCTCTTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039560.3-328s21c1
Sequence:CCGGATGAACTGTGCTCGGCTTTATCTCGAGATAAAGCCGAGCACAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039560.3-1450s21c1
Sequence:CCGGACAGTCAACCTCACCATTAAGCTCGAGCTTAATGGTGAGGTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039560
GCNT7 MISSION shRNA Lentiviral Transduction Particles
glucosaminyl (N-acetyl) transferase family member 7
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000262557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039560.3-554s21c1
Sequence:CCGGGCGGCTTCTCAGAGCGATTTACTCGAGTAAATCGCTCTGAGAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039560.3-1726s21c1
Sequence:CCGGTGAGTAAGAGGCGCATATATACTCGAGTATATATGCGCCTCTTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039560.3-328s21c1
Sequence:CCGGATGAACTGTGCTCGGCTTTATCTCGAGATAAAGCCGAGCACAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039560.3-1450s21c1
Sequence:CCGGACAGTCAACCTCACCATTAAGCTCGAGCTTAATGGTGAGGTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks