EMAIL THIS PAGE TO A FRIEND

GCOM1

GRINL1A complex locus 1

Synonyms: GRINL1A Gcom2 MYZAP MYZAP-POLR2M gcom
Gene ID:
Human(145781) Summary: This locus represents naturally occurring readthrough transcription between the neighboring MYZAP (myocardial zonula adherens protein) and POLR2M (polymerase (RNA) II (DNA directed) polypeptide M) genes on chromosome 15. Alternate splicing results in two readthrough transcript variants that encode different isoforms. One of the readthrough variants encodes a fusion protein that shares sequence identity with each individual gene product. The other variant encodes a protein that shares sequence identity with the upstream gene product but its C-terminal region is distinct due to frameshifts relative to the downstream gene. [provided by RefSeq, Nov 2011]
Rat(363091) GRINL1A complex locus 1
chicken(415404) GRINL1A complex locus 1
Horse(100068476) GRINL1A complex locus 1
dog(478318) GRINL1A complex locus 1
425 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV51835 Anti-GCOM1 antibody produced in rabbit affinity isolated antibody rat, mouse, rabbit, human, horse, guinea pig
western blot pricing
SAB2103517 Anti-GCOM1 antibody produced in rabbit affinity isolated antibody horse, human, guinea pig, mouse, rat, canine, rabbit
western blot pricing
SAB3500969 Anti-MYOZAP antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152451 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018090 Rosetta Predictions human pricing
NM_001018091 Rosetta Predictions human pricing
NM_001018092 Rosetta Predictions human pricing
NM_001018093 Rosetta Predictions human pricing
NM_001018094 Rosetta Predictions human pricing
NM_001018095 Rosetta Predictions human pricing
NM_001018096 Rosetta Predictions human pricing
NM_001018097 Rosetta Predictions human pricing
NM_001018098 Rosetta Predictions human pricing
NM_001018099 Rosetta Predictions human pricing
NM_001018100 Rosetta Predictions human pricing
NM_001018101 Rosetta Predictions human pricing
NM_152451 Rosetta Predictions human pricing
NM_001014211 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153891 predicted 1818
2 SASI_Hs01_00153892 predicted 1770
3 SASI_Hs02_00307002 predicted 489
4 SASI_Hs01_00153895 predicted 312
5 SASI_Hs01_00153896 predicted 517
6 SASI_Hs02_00307003 predicted 1269
7 SASI_Hs01_00153897 predicted 200
8 SASI_Hs01_00153898 predicted 666
9 SASI_Hs01_00153899 predicted 1393
10 SASI_Hs01_00153900 predicted 1847
11 SASI_Hs01_00153893 predicted 1460
12 SASI_Hs01_00153894 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307004 predicted 1031
2 SASI_Hs01_00039262 predicted 973
3 SASI_Hs01_00039263 predicted 490
4 SASI_Hs01_00039264 predicted 310
5 SASI_Hs01_00039265 predicted 519
6 SASI_Hs01_00039266 predicted 1265
7 SASI_Hs01_00039267 predicted 202
8 SASI_Hs01_00039268 predicted 667
9 SASI_Hs01_00039269 predicted 1387
10 SASI_Hs01_00039270 predicted 1307
11 SASI_Hs01_00039261 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086400 predicted 1027
2 SASI_Hs01_00086401 predicted 1431
3 SASI_Hs01_00086402 predicted 984
4 SASI_Hs01_00086403 predicted 502
5 SASI_Hs01_00086404 predicted 317
6 SASI_Hs01_00086405 predicted 518
7 SASI_Hs01_00086406 predicted 1380
8 SASI_Hs01_00086407 predicted 1275
9 SASI_Hs01_00086408 predicted 201
10 SASI_Hs01_00086409 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125804 predicted 1363
2 SASI_Hs01_00125805 predicted 983
3 SASI_Hs01_00125806 predicted 503
4 SASI_Hs01_00125807 predicted 1408
5 SASI_Hs01_00125808 predicted 310
6 SASI_Hs01_00125809 predicted 517
7 SASI_Hs01_00125810 predicted 1273
8 SASI_Hs01_00125811 predicted 201
9 SASI_Hs01_00125812 predicted 672
10 SASI_Hs01_00125813 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195543 predicted 1274
2 SASI_Hs01_00195544 predicted 1315
3 SASI_Hs01_00195545 predicted 316
4 SASI_Hs01_00195546 predicted 524
5 SASI_Hs01_00195547 predicted 842
6 SASI_Hs01_00195548 predicted 204
7 SASI_Hs01_00195549 predicted 678
8 SASI_Hs01_00195550 predicted 1058
9 SASI_Hs01_00195551 predicted 715
10 SASI_Hs01_00195552 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050264 predicted 854
2 SASI_Hs01_00050265 predicted 892
3 SASI_Hs01_00050266 predicted 892
4 SASI_Hs01_00050267 predicted 794
5 SASI_Hs01_00050268 predicted 852
6 SASI_Hs01_00050269 predicted 797
7 SASI_Hs01_00050270 predicted 887
8 SASI_Hs01_00050271 predicted 853
9 SASI_Hs01_00050272 predicted 809
10 SASI_Hs01_00050273 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226242 predicted 943
2 SASI_Hs01_00226243 predicted 982
3 SASI_Hs01_00226244 predicted 978
4 SASI_Hs01_00226245 predicted 891
5 SASI_Hs01_00226246 predicted 952
6 SASI_Hs01_00226247 predicted 891
7 SASI_Hs01_00226248 predicted 981
8 SASI_Hs01_00226249 predicted 946
9 SASI_Hs01_00226250 predicted 905
10 SASI_Hs01_00226251 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104273 predicted 1491
2 SASI_Hs01_00104274 predicted 987
3 SASI_Hs01_00104275 predicted 493
4 SASI_Hs01_00104276 predicted 1292
5 SASI_Hs01_00104277 predicted 319
6 SASI_Hs01_00104278 predicted 522
7 SASI_Hs01_00104279 predicted 205
8 SASI_Hs01_00104280 predicted 671
9 SASI_Hs01_00104281 predicted 1230
10 SASI_Hs01_00104282 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118168 predicted 503
2 SASI_Hs01_00118169 predicted 317
3 SASI_Hs01_00118170 predicted 518
4 SASI_Hs01_00118171 predicted 847
5 SASI_Hs01_00118172 predicted 205
6 SASI_Hs01_00118173 predicted 675
7 SASI_Hs01_00118174 predicted 1309
8 SASI_Hs01_00118175 predicted 1054
9 SASI_Hs01_00118176 predicted 717
10 SASI_Hs01_00118177 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196621 predicted 746
2 SASI_Hs01_00196622 predicted 776
3 SASI_Hs01_00196623 predicted 778
4 SASI_Hs01_00196624 predicted 686
5 SASI_Hs01_00196625 predicted 744
6 SASI_Hs01_00196626 predicted 687
7 SASI_Hs01_00196627 predicted 770
8 SASI_Hs01_00196628 predicted 737
9 SASI_Hs01_00196629 predicted 693
10 SASI_Hs01_00196630 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307005 predicted 456
2 SASI_Hs01_00031179 predicted 938
3 SASI_Hs02_00307006 predicted 754
4 SASI_Hs01_00031181 predicted 979
5 SASI_Hs02_00307007 predicted 492
6 SASI_Hs02_00307008 predicted 307
7 SASI_Hs02_00307009 predicted 520
8 SASI_Hs02_00307010 predicted 790
9 SASI_Hs02_00307011 predicted 672
10 SASI_Hs01_00031182 predicted 882
11 SASI_Hs01_00031180 predicted 986
12 SASI_Hs01_00031183 predicted 948
13 SASI_Hs01_00031184 predicted 891
14 SASI_Hs01_00031185 predicted 975
15 SASI_Hs01_00031186 predicted 944
16 SASI_Hs01_00031187 predicted 906
17 SASI_Hs01_00031188 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170333 predicted 946
2 SASI_Hs01_00170334 predicted 986
3 SASI_Hs01_00170335 predicted 983
4 SASI_Hs01_00170336 predicted 896
5 SASI_Hs01_00170337 predicted 947
6 SASI_Hs01_00170338 predicted 897
7 SASI_Hs01_00170339 predicted 983
8 SASI_Hs01_00170340 predicted 950
9 SASI_Hs01_00170341 predicted 906
10 SASI_Hs01_00170342 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366221 predicted 454
2 SASI_Hs01_00013820 predicted 947
3 SASI_Hs02_00366222 predicted 757
4 SASI_Hs01_00013822 predicted 978
5 SASI_Hs02_00366223 predicted 497
6 SASI_Hs02_00366224 predicted 312
7 SASI_Hs02_00366225 predicted 520
8 SASI_Hs02_00366226 predicted 792
9 SASI_Hs02_00366227 predicted 671
10 SASI_Hs01_00013823 predicted 885
11 SASI_Hs01_00013821 predicted 980
12 SASI_Hs01_00013824 predicted 951
13 SASI_Hs01_00013825 predicted 890
14 SASI_Hs01_00013826 predicted 975
15 SASI_Hs01_00013827 predicted 944
16 SASI_Hs01_00013828 predicted 905
17 SASI_Hs01_00013829 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045944 predicted 1257
2 SASI_Rn01_00045946 predicted 725
3 SASI_Rn02_00201744 predicted 381
4 SASI_Rn01_00045947 predicted 1213
5 SASI_Rn01_00045948 predicted 497
6 SASI_Rn01_00045949 predicted 1413
7 SASI_Rn01_00045950 predicted 259
8 SASI_Rn01_00045951 predicted 578
9 SASI_Rn01_00045952 predicted 1403
10 SASI_Rn01_00045953 predicted 595
11 SASI_Rn01_00045945 predicted 289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152451
GCOM1 MISSION shRNA Bacterial Glycerol Stock
GRINL1A complex locus 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-682s1c1
Sequence:CCGGGCAGACGTATGAAGCATCCATCTCGAGATGGATGCTTCATACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-518s1c1
Sequence:CCGGCAGCAGGAGTATCTGGAGAATCTCGAGATTCTCCAGATACTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-212s1c1
Sequence:CCGGCCAGTTCCTGAGCAATGTGAACTCGAGTTCACATTGCTCAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-448s1c1
Sequence:CCGGGTATGGAGACTATGATGAGATCTCGAGATCTCATCATAGTCTCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-1043s1c1
Sequence:CCGGCAACTTCAACTCCTAGAACATCTCGAGATGTTCTAGGAGTTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-1237s1c1
Sequence:CCGGGCAACAGAAACAGCTCTTAATCTCGAGATTAAGAGCTGTTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-406s1c1
Sequence:CCGGCAAAGATGTGAGAGCCACTTTCTCGAGAAAGTGGCTCTCACATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-1031s1c1
Sequence:CCGGCGTCATCAACTGCAACTTCAACTCGAGTTGAAGTTGCAGTTGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-343s1c1
Sequence:CCGGGCAGAAAGAAATGGTGGTGTACTCGAGTACACCACCATTTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-494s1c1
Sequence:CCGGCAGGAACTATCAGTTTCCCATCTCGAGATGGGAAACTGATAGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-1462s1c1
Sequence:CCGGCCTGGAGTTAACCATGAAGAACTCGAGTTCTTCATGGTTAACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-1180s1c1
Sequence:CCGGCCAGCAGAAGAAAGTCAAGCACTCGAGTGCTTGACTTTCTTCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152451
GCOM1 MISSION shRNA shRNA Plasmid DNA
GRINL1A complex locus 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-682s1c1
Sequence:CCGGGCAGACGTATGAAGCATCCATCTCGAGATGGATGCTTCATACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-518s1c1
Sequence:CCGGCAGCAGGAGTATCTGGAGAATCTCGAGATTCTCCAGATACTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-212s1c1
Sequence:CCGGCCAGTTCCTGAGCAATGTGAACTCGAGTTCACATTGCTCAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-448s1c1
Sequence:CCGGGTATGGAGACTATGATGAGATCTCGAGATCTCATCATAGTCTCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-1043s1c1
Sequence:CCGGCAACTTCAACTCCTAGAACATCTCGAGATGTTCTAGGAGTTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-1237s1c1
Sequence:CCGGGCAACAGAAACAGCTCTTAATCTCGAGATTAAGAGCTGTTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-406s1c1
Sequence:CCGGCAAAGATGTGAGAGCCACTTTCTCGAGAAAGTGGCTCTCACATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-1031s1c1
Sequence:CCGGCGTCATCAACTGCAACTTCAACTCGAGTTGAAGTTGCAGTTGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-343s1c1
Sequence:CCGGGCAGAAAGAAATGGTGGTGTACTCGAGTACACCACCATTTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-494s1c1
Sequence:CCGGCAGGAACTATCAGTTTCCCATCTCGAGATGGGAAACTGATAGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-1462s1c1
Sequence:CCGGCCTGGAGTTAACCATGAAGAACTCGAGTTCTTCATGGTTAACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-1180s1c1
Sequence:CCGGCCAGCAGAAGAAAGTCAAGCACTCGAGTGCTTGACTTTCTTCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152451
GCOM1 MISSION shRNA Lentiviral Transduction Particles
GRINL1A complex locus 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-682s1c1
Sequence:CCGGGCAGACGTATGAAGCATCCATCTCGAGATGGATGCTTCATACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-518s1c1
Sequence:CCGGCAGCAGGAGTATCTGGAGAATCTCGAGATTCTCCAGATACTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-212s1c1
Sequence:CCGGCCAGTTCCTGAGCAATGTGAACTCGAGTTCACATTGCTCAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-448s1c1
Sequence:CCGGGTATGGAGACTATGATGAGATCTCGAGATCTCATCATAGTCTCCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-1043s1c1
Sequence:CCGGCAACTTCAACTCCTAGAACATCTCGAGATGTTCTAGGAGTTGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-1237s1c1
Sequence:CCGGGCAACAGAAACAGCTCTTAATCTCGAGATTAAGAGCTGTTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-406s1c1
Sequence:CCGGCAAAGATGTGAGAGCCACTTTCTCGAGAAAGTGGCTCTCACATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-1031s1c1
Sequence:CCGGCGTCATCAACTGCAACTTCAACTCGAGTTGAAGTTGCAGTTGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-343s1c1
Sequence:CCGGGCAGAAAGAAATGGTGGTGTACTCGAGTACACCACCATTTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-494s1c1
Sequence:CCGGCAGGAACTATCAGTTTCCCATCTCGAGATGGGAAACTGATAGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152451.1-1462s1c1
Sequence:CCGGCCTGGAGTTAACCATGAAGAACTCGAGTTCTTCATGGTTAACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152451.1-1180s1c1
Sequence:CCGGCCAGCAGAAGAAAGTCAAGCACTCGAGTGCTTGACTTTCTTCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks