EMAIL THIS PAGE TO A FRIEND

GCSAM

germinal center-associated, signaling and motility

185 Gene Product Result for
Synonyms: GCAT2 GCET2 HGAL
UniProtKB ID: Q8N6F7, C9JD17, C9JUG6
Gene ID:
Human(257144) Summary: This gene encodes a protein which may function in signal transduction pathways and whose expression is elevated in germinal cell lymphomas. It contains a putative PDZ-interacting domain, an immunoreceptor tyrosine-based activation motif (ITAM), and two putative SH2 binding sites. In B cells, its expression is specifically induced by interleukin-4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(14525) germinal center associated, signaling and motility
Rat(685692) germinal center-associated, signaling and motility
domestic guinea pig(100733880) germinal center-associated, signaling and motility
naked mole-rat(101700094) germinal center-associated, signaling and motility
sheep(101120459) germinal center-associated, signaling and motility
domestic cat(101095363) germinal center-associated, signaling and motility
dog(100684299) germinal center-associated, signaling and motility
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152785 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152785 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152785 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008099 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008099 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008099 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025481 MISSION® esiRNA esiRNA human GCET2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008756 Rosetta Predictions human pricing
NM_152785 Rosetta Predictions human pricing
XM_001064866 Rosetta Predictions rat pricing
NM_008099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119568 predicted 1214
2 SASI_Hs01_00119569 predicted 1077
3 SASI_Hs02_00305562 predicted 1074
4 SASI_Hs01_00119571 predicted 1228
5 SASI_Hs01_00119572 predicted 1071
6 SASI_Hs01_00119570 predicted 1180
7 SASI_Hs01_00119573 predicted 1068
8 SASI_Hs01_00119574 predicted 518
9 SASI_Hs01_00119576 predicted 930
10 SASI_Hs02_00305563 predicted 775
11 SASI_Hs01_00119575 predicted 1316
12 SASI_Hs01_00119577 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239612 predicted 1057
2 SASI_Hs01_00239613 predicted 1049
3 SASI_Hs01_00239614 predicted 918
4 SASI_Hs01_00239615 predicted 1031
5 SASI_Hs02_00366728 predicted 906
6 SASI_Hs01_00239617 predicted 998
7 SASI_Hs01_00239618 predicted 1054
8 SASI_Hs01_00239619 predicted 902
9 SASI_Hs01_00239616 predicted 1010
10 SASI_Hs01_00239620 predicted 896
11 SASI_Hs01_00239621 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312028 predicted 335
2 SASI_Rn02_00312029 predicted 217
3 SASI_Rn02_00312030 predicted 430
4 SASI_Rn02_00312031 predicted 417
5 SASI_Rn02_00312032 predicted 377
6 SASI_Rn02_00312033 predicted 351
7 SASI_Rn02_00312034 predicted 281
8 SASI_Rn02_00312035 predicted 402
9 SASI_Rn02_00312036 predicted 286
10 SASI_Rn02_00312037 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124189 predicted 396
2 SASI_Mm01_00124190 predicted 1046
3 SASI_Mm02_00313127 predicted 214
4 SASI_Mm01_00124191 predicted 1049
5 SASI_Mm01_00124193 predicted 601
6 SASI_Mm01_00124194 predicted 597
7 SASI_Mm01_00124195 predicted 299
8 SASI_Mm01_00124196 predicted 761
9 SASI_Mm01_00124197 predicted 215
10 SASI_Mm01_00124198 predicted 338
11 SASI_Mm01_00124192 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152785
GCSAM MISSION shRNA Bacterial Glycerol Stock
germinal center-associated, signaling and motility
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-424s1c1
Sequence:CCGGCTATGAGAATGTTCCCTGCAACTCGAGTTGCAGGGAACATTCTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-492s1c1
Sequence:CCGGCACTTCTACATATGCCTTCTACTCGAGTAGAAGGCATATGTAGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-202s1c1
Sequence:CCGGCAGATGCTGGGATCACCATATCTCGAGATATGGTGATCCCAGCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-566s1c1
Sequence:CCGGCACAGAATCTCCTCTCACTTTCTCGAGAAAGTGAGAGGAGATTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152785.2-471s1c1
Sequence:CCGGGAGGAACTGAGACTGAGTATTCTCGAGAATACTCAGTCTCAGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-479s1c1
Sequence:CCGGGAGACTGAGTATTCACTTCTACTCGAGTAGAAGTGAATACTCAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152785.3-404s21c1
Sequence:CCGGGCTATACCCTCATCAATCATCCTCGAGGATGATTGATGAGGGTATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152785.3-1061s21c1
Sequence:CCGGAGCTTTACTCATCATACTAAGCTCGAGCTTAGTATGATGAGTAAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152785.3-1006s21c1
Sequence:CCGGTGTCTGGGATCTTCTTATAAACTCGAGTTTATAAGAAGATCCCAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152785
GCSAM MISSION shRNA shRNA Plasmid DNA
germinal center-associated, signaling and motility
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-424s1c1
Sequence:CCGGCTATGAGAATGTTCCCTGCAACTCGAGTTGCAGGGAACATTCTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-492s1c1
Sequence:CCGGCACTTCTACATATGCCTTCTACTCGAGTAGAAGGCATATGTAGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-202s1c1
Sequence:CCGGCAGATGCTGGGATCACCATATCTCGAGATATGGTGATCCCAGCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-566s1c1
Sequence:CCGGCACAGAATCTCCTCTCACTTTCTCGAGAAAGTGAGAGGAGATTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152785.2-471s1c1
Sequence:CCGGGAGGAACTGAGACTGAGTATTCTCGAGAATACTCAGTCTCAGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-479s1c1
Sequence:CCGGGAGACTGAGTATTCACTTCTACTCGAGTAGAAGTGAATACTCAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152785.3-404s21c1
Sequence:CCGGGCTATACCCTCATCAATCATCCTCGAGGATGATTGATGAGGGTATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152785.3-1061s21c1
Sequence:CCGGAGCTTTACTCATCATACTAAGCTCGAGCTTAGTATGATGAGTAAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152785.3-1006s21c1
Sequence:CCGGTGTCTGGGATCTTCTTATAAACTCGAGTTTATAAGAAGATCCCAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152785
GCSAM MISSION shRNA Lentiviral Transduction Particles
germinal center-associated, signaling and motility
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-424s1c1
Sequence:CCGGCTATGAGAATGTTCCCTGCAACTCGAGTTGCAGGGAACATTCTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-492s1c1
Sequence:CCGGCACTTCTACATATGCCTTCTACTCGAGTAGAAGGCATATGTAGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-202s1c1
Sequence:CCGGCAGATGCTGGGATCACCATATCTCGAGATATGGTGATCCCAGCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-566s1c1
Sequence:CCGGCACAGAATCTCCTCTCACTTTCTCGAGAAAGTGAGAGGAGATTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152785.2-471s1c1
Sequence:CCGGGAGGAACTGAGACTGAGTATTCTCGAGAATACTCAGTCTCAGTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152785.2-479s1c1
Sequence:CCGGGAGACTGAGTATTCACTTCTACTCGAGTAGAAGTGAATACTCAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152785.3-404s21c1
Sequence:CCGGGCTATACCCTCATCAATCATCCTCGAGGATGATTGATGAGGGTATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152785.3-1061s21c1
Sequence:CCGGAGCTTTACTCATCATACTAAGCTCGAGCTTAGTATGATGAGTAAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152785.3-1006s21c1
Sequence:CCGGTGTCTGGGATCTTCTTATAAACTCGAGTTTATAAGAAGATCCCAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008099
GCSAM MISSION shRNA Bacterial Glycerol Stock
germinal center-associated, signaling and motility
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008099.2-430s1c1
Sequence:CCGGCTGAGTATTCGGTTCTCCGTTCTCGAGAACGGAGAACCGAATACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008099.2-394s1c1
Sequence:CCGGCTGAGAGACACAAAGAGTCTTCTCGAGAAGACTCTTTGTGTCTCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008099.2-264s1c1
Sequence:CCGGCCCGTTCAGGACAATGCTAATCTCGAGATTAGCATTGTCCTGAACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008099.2-297s1c1
Sequence:CCGGGAAGAGTTGTGCTACATCCTTCTCGAGAAGGATGTAGCACAACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008099.2-2883s1c1
Sequence:CCGGCCCACGTCAATCATAAATCAACTCGAGTTGATTTATGATTGACGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008099
GCSAM MISSION shRNA shRNA Plasmid DNA
germinal center-associated, signaling and motility
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008099.2-430s1c1
Sequence:CCGGCTGAGTATTCGGTTCTCCGTTCTCGAGAACGGAGAACCGAATACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008099.2-394s1c1
Sequence:CCGGCTGAGAGACACAAAGAGTCTTCTCGAGAAGACTCTTTGTGTCTCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008099.2-264s1c1
Sequence:CCGGCCCGTTCAGGACAATGCTAATCTCGAGATTAGCATTGTCCTGAACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008099.2-297s1c1
Sequence:CCGGGAAGAGTTGTGCTACATCCTTCTCGAGAAGGATGTAGCACAACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008099.2-2883s1c1
Sequence:CCGGCCCACGTCAATCATAAATCAACTCGAGTTGATTTATGATTGACGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008099
GCSAM MISSION shRNA Lentiviral Transduction Particles
germinal center-associated, signaling and motility
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008099.2-430s1c1
Sequence:CCGGCTGAGTATTCGGTTCTCCGTTCTCGAGAACGGAGAACCGAATACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008099.2-394s1c1
Sequence:CCGGCTGAGAGACACAAAGAGTCTTCTCGAGAAGACTCTTTGTGTCTCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008099.2-264s1c1
Sequence:CCGGCCCGTTCAGGACAATGCTAATCTCGAGATTAGCATTGTCCTGAACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008099.2-297s1c1
Sequence:CCGGGAAGAGTTGTGCTACATCCTTCTCGAGAAGGATGTAGCACAACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008099.2-2883s1c1
Sequence:CCGGCCCACGTCAATCATAAATCAACTCGAGTTGATTTATGATTGACGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)