EMAIL THIS PAGE TO A FRIEND

GCSAML

germinal center-associated, signaling and motility-like

34 Gene Product Result for
Synonyms: C1orf150
Species: Human GCSAML(148823), domestic cat GCSAML(101095074)
UniProtKB ID: Q5JQS6, B2R4Y5, B3KX46, Q5JQT3
Gene ID:
domestic cat(101095074) germinal center-associated, signaling and motility-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145278 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012531 MISSION® esiRNA esiRNA targeting human C1orf150 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145278 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116069 predicted 238
2 SASI_Hs01_00116070 predicted 408
3 SASI_Hs01_00116071 predicted 322
4 SASI_Hs01_00116072 predicted 364
5 SASI_Hs01_00116073 predicted 428
6 SASI_Hs01_00116074 predicted 287
7 SASI_Hs01_00116075 predicted 285
8 SASI_Hs02_00365154 predicted 409
9 SASI_Hs01_00116076 predicted 412
10 SASI_Hs01_00116077 predicted 237
11 SASI_Hs01_00116078 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145278
GCSAML MISSION shRNA Bacterial Glycerol Stock
germinal center-associated, signaling and motility-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145278.1-2267s1c1
Sequence:CCGGCGCACATTGGACCATCAGAAACTCGAGTTTCTGATGGTCCAATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145278.1-378s1c1
Sequence:CCGGGCCCTTCTTAGGACTTCTGTTCTCGAGAACAGAAGTCCTAAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145278.1-1358s1c1
Sequence:CCGGGCTCAGAATCAACCTCTTTAACTCGAGTTAAAGAGGTTGATTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145278.1-303s1c1
Sequence:CCGGGATGATGGCTATGAGAACATTCTCGAGAATGTTCTCATAGCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134329    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145278.1-682s1c1
Sequence:CCGGGCTTGTAAAGTTTGAGGACATCTCGAGATGTCCTCAAACTTTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145278.1-357s1c1
Sequence:CCGGGAAAGGTCAGAGACAGAATATCTCGAGATATTCTGTCTCTGACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145278.1-1968s1c1
Sequence:CCGGGCTTCCTAATTTGGAGACAAACTCGAGTTTGTCTCCAAATTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145278.1-366s1c1
Sequence:CCGGGAGACAGAATATGCCCTTCTTCTCGAGAAGAAGGGCATATTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145278.1-243s1c1
Sequence:CCGGGAAGTGTGCTACACTGTCATTCTCGAGAATGACAGTGTAGCACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145278.1-107s1c1
Sequence:CCGGGAAAGGAAACCCAGATGAGGACTCGAGTCCTCATCTGGGTTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145278
GCSAML MISSION shRNA shRNA Plasmid DNA
germinal center-associated, signaling and motility-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145278.1-2267s1c1
Sequence:CCGGCGCACATTGGACCATCAGAAACTCGAGTTTCTGATGGTCCAATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145278.1-378s1c1
Sequence:CCGGGCCCTTCTTAGGACTTCTGTTCTCGAGAACAGAAGTCCTAAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145278.1-1358s1c1
Sequence:CCGGGCTCAGAATCAACCTCTTTAACTCGAGTTAAAGAGGTTGATTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145278.1-303s1c1
Sequence:CCGGGATGATGGCTATGAGAACATTCTCGAGAATGTTCTCATAGCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134329    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145278.1-682s1c1
Sequence:CCGGGCTTGTAAAGTTTGAGGACATCTCGAGATGTCCTCAAACTTTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145278.1-357s1c1
Sequence:CCGGGAAAGGTCAGAGACAGAATATCTCGAGATATTCTGTCTCTGACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145278.1-1968s1c1
Sequence:CCGGGCTTCCTAATTTGGAGACAAACTCGAGTTTGTCTCCAAATTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145278.1-366s1c1
Sequence:CCGGGAGACAGAATATGCCCTTCTTCTCGAGAAGAAGGGCATATTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145278.1-243s1c1
Sequence:CCGGGAAGTGTGCTACACTGTCATTCTCGAGAATGACAGTGTAGCACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145278.1-107s1c1
Sequence:CCGGGAAAGGAAACCCAGATGAGGACTCGAGTCCTCATCTGGGTTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145278
GCSAML MISSION shRNA Lentiviral Transduction Particles
germinal center-associated, signaling and motility-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145278.1-2267s1c1
Sequence:CCGGCGCACATTGGACCATCAGAAACTCGAGTTTCTGATGGTCCAATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145278.1-378s1c1
Sequence:CCGGGCCCTTCTTAGGACTTCTGTTCTCGAGAACAGAAGTCCTAAGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145278.1-1358s1c1
Sequence:CCGGGCTCAGAATCAACCTCTTTAACTCGAGTTAAAGAGGTTGATTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145278.1-303s1c1
Sequence:CCGGGATGATGGCTATGAGAACATTCTCGAGAATGTTCTCATAGCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134329    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145278.1-682s1c1
Sequence:CCGGGCTTGTAAAGTTTGAGGACATCTCGAGATGTCCTCAAACTTTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145278.1-357s1c1
Sequence:CCGGGAAAGGTCAGAGACAGAATATCTCGAGATATTCTGTCTCTGACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145278.1-1968s1c1
Sequence:CCGGGCTTCCTAATTTGGAGACAAACTCGAGTTTGTCTCCAAATTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145278.1-366s1c1
Sequence:CCGGGAGACAGAATATGCCCTTCTTCTCGAGAAGAAGGGCATATTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145278.1-243s1c1
Sequence:CCGGGAAGTGTGCTACACTGTCATTCTCGAGAATGACAGTGTAGCACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145278.1-107s1c1
Sequence:CCGGGAAAGGAAACCCAGATGAGGACTCGAGTCCTCATCTGGGTTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks