EMAIL THIS PAGE TO A FRIEND

GCSH

glycine cleavage system protein H (aminomethyl carrier)

113 Gene Product Result for
Synonyms: GCE NKH
UniProtKB ID: P23434, Q9H1E9
Gene ID:
Human(2653) Summary: Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the H protein, which transfers the methylamine group of glycine from the P protein to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH). Two transcript variants, one protein-coding and the other probably not protein-coding,have been found for this gene. Also, several transcribed and non-transcribed pseudogenes of this gene exist throughout the genome.[provided by RefSeq, Jan 2010]
Mouse(68133) glycine cleavage system protein H (aminomethyl carrier)
Rat(171133) glycine cleavage system protein H (aminomethyl carrier)
sheep(101120772) glycine cleavage system protein H (aminomethyl carrier)
Domestic Rabbit(100009476) glycine cleavage system protein H (aminomethyl carrier)
naked mole-rat(101724619) glycine cleavage system protein H (aminomethyl carrier)
domestic guinea pig(100721850) glycine cleavage system protein H (aminomethyl carrier)
chicken(415803) glycine cleavage system protein H (aminomethyl carrier)
domestic cat(101084333) glycine cleavage system protein H (aminomethyl carrier)
cow(317723) glycine cleavage system protein H (aminomethyl carrier)
dog(479633) glycine cleavage system H protein, mitochondrial-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004483 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004483 Rosetta Predictions human pricing
NM_133598 Rosetta Predictions rat pricing
XM_579628 Rosetta Predictions rat pricing
NM_026572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137151 predicted 286
2 SASI_Hs01_00137157 predicted 251
3 SASI_Hs01_00137152 predicted 328
4 SASI_Hs01_00137153 predicted 329
5 SASI_Hs01_00137154 predicted 262
6 SASI_Hs01_00137155 predicted 256
7 SASI_Hs01_00137156 predicted 240
8 SASI_Hs02_00337707 predicted 429
9 SASI_Hs01_00137159 predicted 446
10 SASI_Hs02_00337708 predicted 418
11 SASI_Hs01_00137158 predicted 451
12 SASI_Hs01_00137160 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133598 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267810 predicted 447
2 SASI_Rn02_00267811 predicted 669
3 SASI_Rn02_00267812 predicted 655
4 SASI_Rn01_00112794 predicted 254
5 SASI_Rn02_00267813 predicted 674
6 SASI_Rn02_00267814 predicted 476
7 SASI_Rn02_00267815 predicted 414
8 SASI_Rn02_00267816 predicted 504
9 SASI_Rn01_00112798 predicted 273
10 SASI_Rn02_00267817 predicted 477
11 SASI_Rn01_00112791 predicted 800
12 SASI_Rn01_00112792 predicted 819
13 SASI_Rn01_00112793 predicted 453
14 SASI_Rn01_00112795 predicted 771
15 SASI_Rn01_00112796 predicted 812
16 SASI_Rn01_00112797 predicted 381
17 SASI_Rn01_00112799 predicted 379
18 SASI_Rn01_00112800 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150364 predicted 988
2 SASI_Rn01_00150365 predicted 218
3 SASI_Rn01_00150366 predicted 278
4 SASI_Rn01_00150367 predicted 274
5 SASI_Rn01_00150368 predicted 225
6 SASI_Rn01_00150369 predicted 246
7 SASI_Rn01_00150370 predicted 310
8 SASI_Rn01_00150371 predicted 982
9 SASI_Rn01_00150372 predicted 233
10 SASI_Rn01_00150373 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135050 predicted 611
2 SASI_Mm01_00135051 predicted 201
3 SASI_Mm02_00330524 predicted 411
4 SASI_Mm01_00135052 predicted 602
5 SASI_Mm01_00135053 predicted 636
6 SASI_Mm01_00135054 predicted 630
7 SASI_Mm01_00135055 predicted 348
8 SASI_Mm01_00135056 predicted 631
9 SASI_Mm01_00135057 predicted 614
10 SASI_Mm01_00135058 predicted 428
11 SASI_Mm01_00135059 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026572
VALIDATED
GCSH MISSION shRNA Bacterial Glycerol Stock
glycine cleavage system protein H (aminomethyl carrier)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-466s1c1
Sequence:CCGGGACCCTTCAGAGATGGATGAACTCGAGTTCATCCATCTCTGAAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-468s1c1
Sequence:CCGGCCCTTCAGAGATGGATGAATTCTCGAGAATTCATCCATCTCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-887s1c1
Sequence:CCGGCGGTCTACACAACAAGTTCTACTCGAGTAGAACTTGTTGTGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-432s1c1
Sequence:CCGGCGAAGATGGTTGGCTGATCAACTCGAGTTGATCAGCCAACCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-273s1c1
Sequence:CCGGTCTGCCTGAAGTTGGGACAAACTCGAGTTTGTCCCAACTTCAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026572.3-886s21c1
Sequence:CCGGCGGTCTACACAACAAGTTCTACTCGAGTAGAACTTGTTGTGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026572.3-272s21c1
Sequence:CCGGTCTGCCTGAAGTTGGGACAAACTCGAGTTTGTCCCAACTTCAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026572.3-467s21c1
Sequence:CCGGCCCTTCAGAGATGGATGAATTCTCGAGAATTCATCCATCTCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026572.3-431s21c1
Sequence:CCGGCGAAGATGGTTGGCTGATCAACTCGAGTTGATCAGCCAACCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026572
VALIDATED
GCSH MISSION shRNA shRNA Plasmid DNA
glycine cleavage system protein H (aminomethyl carrier)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-466s1c1
Sequence:CCGGGACCCTTCAGAGATGGATGAACTCGAGTTCATCCATCTCTGAAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-468s1c1
Sequence:CCGGCCCTTCAGAGATGGATGAATTCTCGAGAATTCATCCATCTCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-887s1c1
Sequence:CCGGCGGTCTACACAACAAGTTCTACTCGAGTAGAACTTGTTGTGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-432s1c1
Sequence:CCGGCGAAGATGGTTGGCTGATCAACTCGAGTTGATCAGCCAACCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-273s1c1
Sequence:CCGGTCTGCCTGAAGTTGGGACAAACTCGAGTTTGTCCCAACTTCAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026572.3-886s21c1
Sequence:CCGGCGGTCTACACAACAAGTTCTACTCGAGTAGAACTTGTTGTGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026572.3-272s21c1
Sequence:CCGGTCTGCCTGAAGTTGGGACAAACTCGAGTTTGTCCCAACTTCAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026572.3-467s21c1
Sequence:CCGGCCCTTCAGAGATGGATGAATTCTCGAGAATTCATCCATCTCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026572.3-431s21c1
Sequence:CCGGCGAAGATGGTTGGCTGATCAACTCGAGTTGATCAGCCAACCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026572
VALIDATED
GCSH MISSION shRNA Lentiviral Transduction Particles
glycine cleavage system protein H (aminomethyl carrier)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-466s1c1
Sequence:CCGGGACCCTTCAGAGATGGATGAACTCGAGTTCATCCATCTCTGAAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-468s1c1
Sequence:CCGGCCCTTCAGAGATGGATGAATTCTCGAGAATTCATCCATCTCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-887s1c1
Sequence:CCGGCGGTCTACACAACAAGTTCTACTCGAGTAGAACTTGTTGTGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-432s1c1
Sequence:CCGGCGAAGATGGTTGGCTGATCAACTCGAGTTGATCAGCCAACCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026572.1-273s1c1
Sequence:CCGGTCTGCCTGAAGTTGGGACAAACTCGAGTTTGTCCCAACTTCAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026572.3-886s21c1
Sequence:CCGGCGGTCTACACAACAAGTTCTACTCGAGTAGAACTTGTTGTGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026572.3-272s21c1
Sequence:CCGGTCTGCCTGAAGTTGGGACAAACTCGAGTTTGTCCCAACTTCAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026572.3-467s21c1
Sequence:CCGGCCCTTCAGAGATGGATGAATTCTCGAGAATTCATCCATCTCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026572.3-431s21c1
Sequence:CCGGCGAAGATGGTTGGCTGATCAACTCGAGTTGATCAGCCAACCATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004483
VALIDATED
GCSH MISSION shRNA Bacterial Glycerol Stock
glycine cleavage system protein H (aminomethyl carrier)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-452s1c1
Sequence:CCGGCAGGACTTGTAAACAAATCTTCTCGAGAAGATTTGTTTACAAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-526s1c1
Sequence:CCGGGATGAACTTATGAGTGAAGAACTCGAGTTCTTCACTCATAAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-389s1c1
Sequence:CCGGGTGAACTCTATTCTCCTTTATCTCGAGATAAAGGAGAATAGAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-208s1c1
Sequence:CCGGGTGCGTAAATTCACAGAGAAACTCGAGTTTCTCTGTGAATTTACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-293s1c1
Sequence:CCGGCGTTGGGAGATGTTGTTTATTCTCGAGAATAAACAACATCTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004483.4-297s21c1
Sequence:CCGGGAACAGTGGGAATCAGCAATTCTCGAGAATTGCTGATTCCCACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004483.4-975s21c1
Sequence:CCGGTTTGGGATGAAATACTTAATGCTCGAGCATTAAGTATTTCATCCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004483.4-685s21c1
Sequence:CCGGGTGGATAGAAGACTTAGAATACTCGAGTATTCTAAGTCTTCTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004483.4-1054s21c1
Sequence:CCGGTGAGGAACACCACTATCTTAACTCGAGTTAAGATAGTGGTGTTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004483.4-448s21c1
Sequence:CCGGAGGAGAAGTAACTGAAATTAACTCGAGTTAATTTCAGTTACTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004483
VALIDATED
GCSH MISSION shRNA shRNA Plasmid DNA
glycine cleavage system protein H (aminomethyl carrier)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-452s1c1
Sequence:CCGGCAGGACTTGTAAACAAATCTTCTCGAGAAGATTTGTTTACAAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-526s1c1
Sequence:CCGGGATGAACTTATGAGTGAAGAACTCGAGTTCTTCACTCATAAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-389s1c1
Sequence:CCGGGTGAACTCTATTCTCCTTTATCTCGAGATAAAGGAGAATAGAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-208s1c1
Sequence:CCGGGTGCGTAAATTCACAGAGAAACTCGAGTTTCTCTGTGAATTTACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-293s1c1
Sequence:CCGGCGTTGGGAGATGTTGTTTATTCTCGAGAATAAACAACATCTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004483.4-297s21c1
Sequence:CCGGGAACAGTGGGAATCAGCAATTCTCGAGAATTGCTGATTCCCACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004483.4-975s21c1
Sequence:CCGGTTTGGGATGAAATACTTAATGCTCGAGCATTAAGTATTTCATCCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004483.4-685s21c1
Sequence:CCGGGTGGATAGAAGACTTAGAATACTCGAGTATTCTAAGTCTTCTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004483.4-1054s21c1
Sequence:CCGGTGAGGAACACCACTATCTTAACTCGAGTTAAGATAGTGGTGTTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004483.4-448s21c1
Sequence:CCGGAGGAGAAGTAACTGAAATTAACTCGAGTTAATTTCAGTTACTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004483
VALIDATED
GCSH MISSION shRNA Lentiviral Transduction Particles
glycine cleavage system protein H (aminomethyl carrier)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-452s1c1
Sequence:CCGGCAGGACTTGTAAACAAATCTTCTCGAGAAGATTTGTTTACAAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-526s1c1
Sequence:CCGGGATGAACTTATGAGTGAAGAACTCGAGTTCTTCACTCATAAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-389s1c1
Sequence:CCGGGTGAACTCTATTCTCCTTTATCTCGAGATAAAGGAGAATAGAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-208s1c1
Sequence:CCGGGTGCGTAAATTCACAGAGAAACTCGAGTTTCTCTGTGAATTTACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004483.2-293s1c1
Sequence:CCGGCGTTGGGAGATGTTGTTTATTCTCGAGAATAAACAACATCTCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004483.4-297s21c1
Sequence:CCGGGAACAGTGGGAATCAGCAATTCTCGAGAATTGCTGATTCCCACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004483.4-975s21c1
Sequence:CCGGTTTGGGATGAAATACTTAATGCTCGAGCATTAAGTATTTCATCCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004483.4-685s21c1
Sequence:CCGGGTGGATAGAAGACTTAGAATACTCGAGTATTCTAAGTCTTCTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004483.4-1054s21c1
Sequence:CCGGTGAGGAACACCACTATCTTAACTCGAGTTAAGATAGTGGTGTTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004483.4-448s21c1
Sequence:CCGGAGGAGAAGTAACTGAAATTAACTCGAGTTAATTTCAGTTACTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks