EMAIL THIS PAGE TO A FRIEND

GDA

guanine deaminase

293 Gene Product Result for
Synonyms: CYPIN GUANASE NEDASIN
UniProtKB ID: Q9Y2T3, B4DTY5, Q5SZC7, Q9H335, Q9ULG2
Gene ID:
Human(9615) Summary: This gene encodes an enzyme responsible for the hydrolytic deamination of guanine. Studies in rat ortholog suggest this gene plays a role in microtubule assembly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(14544) guanine deaminase
Rat(83585) guanine deaminase
domestic guinea pig(100727963) guanine deaminase
naked mole-rat(101713028) guanine deaminase
sheep(101123530) guanine deaminase
Zebrafish(553701) guanine deaminase
chicken(427253) guanine deaminase
domestic cat(101089902) guanine deaminase
cow(525937) guanine deaminase
Horse(100050096) guanine deaminase
dog(484169) guanine deaminase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004293 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010266 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010266 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010266 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059711 MISSION® esiRNA esiRNA human GDA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004293 Rosetta Predictions human pricing
NM_031776 Rosetta Predictions rat pricing
NM_010266 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117628 predicted 1218
2 SASI_Hs01_00117630 predicted 552
3 SASI_Hs01_00117631 predicted 883
4 SASI_Hs01_00117632 predicted 1275
5 SASI_Hs01_00117633 predicted 1041
6 SASI_Hs01_00117634 predicted 1485
7 SASI_Hs01_00117635 predicted 742
8 SASI_Hs01_00117636 predicted 1508
9 SASI_Hs01_00117637 predicted 668
10 SASI_Hs02_00337296 predicted 1036
11 SASI_Hs01_00117629 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051820 predicted 1099
2 SASI_Rn02_00265213 predicted 529
3 SASI_Rn02_00265214 predicted 738
4 SASI_Rn01_00051821 predicted 978
5 SASI_Rn01_00051823 predicted 504
6 SASI_Rn01_00051824 predicted 1011
7 SASI_Rn01_00051825 predicted 1023
8 SASI_Rn01_00051826 predicted 550
9 SASI_Rn01_00051827 predicted 816
10 SASI_Rn01_00051828 predicted 742
11 SASI_Rn01_00051822 predicted 265
12 SASI_Rn01_00051829 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028900 predicted 546
2 SASI_Mm01_00028901 predicted 341
3 SASI_Mm01_00028902 predicted 677
4 SASI_Mm01_00028903 predicted 920
5 SASI_Mm02_00318179 predicted 1468
6 SASI_Mm01_00028904 predicted 631
7 SASI_Mm01_00028906 predicted 1484
8 SASI_Mm02_00318180 predicted 1500
9 SASI_Mm01_00028907 predicted 1569
10 SASI_Mm01_00028908 predicted 1060
11 SASI_Mm01_00028905 predicted 878
12 SASI_Mm01_00028909 predicted 1204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004293
GDA MISSION shRNA Bacterial Glycerol Stock
guanine deaminase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004293.3-521s21c1
Sequence:CCGGGATTCCAGAACATCGACTTTGCTCGAGCAAAGTCGATGTTCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-1196s1c1
Sequence:CCGGCCATGCTTGATGCAATCAGAACTCGAGTTCTGATTGCATCAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-1436s1c1
Sequence:CCGGGTGATATTTCTGAGGCTGTTACTCGAGTAACAGCCTCAGAAATATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-366s1c1
Sequence:CCGGGCCGTGTGAAATAAGAGAACTCTCGAGAGTTCTCTTATTTCACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-743s1c1
Sequence:CCGGCGATCAAGGAAACTGAGAGATCTCGAGATCTCTCAGTTTCCTTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-598s1c1
Sequence:CCGGGCTTGTTACTTTGCAACAATTCTCGAGAATTGTTGCAAAGTAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004293
GDA MISSION shRNA shRNA Plasmid DNA
guanine deaminase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004293.3-521s21c1
Sequence:CCGGGATTCCAGAACATCGACTTTGCTCGAGCAAAGTCGATGTTCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-1196s1c1
Sequence:CCGGCCATGCTTGATGCAATCAGAACTCGAGTTCTGATTGCATCAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-1436s1c1
Sequence:CCGGGTGATATTTCTGAGGCTGTTACTCGAGTAACAGCCTCAGAAATATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-366s1c1
Sequence:CCGGGCCGTGTGAAATAAGAGAACTCTCGAGAGTTCTCTTATTTCACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-743s1c1
Sequence:CCGGCGATCAAGGAAACTGAGAGATCTCGAGATCTCTCAGTTTCCTTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-598s1c1
Sequence:CCGGGCTTGTTACTTTGCAACAATTCTCGAGAATTGTTGCAAAGTAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004293
GDA MISSION shRNA Lentiviral Transduction Particles
guanine deaminase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004293.3-521s21c1
Sequence:CCGGGATTCCAGAACATCGACTTTGCTCGAGCAAAGTCGATGTTCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-1196s1c1
Sequence:CCGGCCATGCTTGATGCAATCAGAACTCGAGTTCTGATTGCATCAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-1436s1c1
Sequence:CCGGGTGATATTTCTGAGGCTGTTACTCGAGTAACAGCCTCAGAAATATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-366s1c1
Sequence:CCGGGCCGTGTGAAATAAGAGAACTCTCGAGAGTTCTCTTATTTCACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-743s1c1
Sequence:CCGGCGATCAAGGAAACTGAGAGATCTCGAGATCTCTCAGTTTCCTTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004293.2-598s1c1
Sequence:CCGGGCTTGTTACTTTGCAACAATTCTCGAGAATTGTTGCAAAGTAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010266
GDA MISSION shRNA Bacterial Glycerol Stock
guanine deaminase
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000454178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010266.2-1540s21c1
Sequence:CCGGCCTTGGACATCTGCGACATTCCTCGAGGAATGTCGCAGATGTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-512s1c1
Sequence:CCGGGCTTGCTACTTTGGAACAATTCTCGAGAATTGTTCCAAAGTAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-1364s1c1
Sequence:CCGGGCTGTTATCCAGAAGTTTCTTCTCGAGAAGAAACTTCTGGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-546s1c1
Sequence:CCGGCCCTGATCCTTGCGGAAATTACTCGAGTAATTTCCGCAAGGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-1399s1c1
Sequence:CCGGCCGAAATATTGAGGAGGTTTACTCGAGTAAACCTCCTCAATATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-1142s1c1
Sequence:CCGGGTTTCCAATGTCCTCTTAATTCTCGAGAATTAAGAGGACATTGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010266
GDA MISSION shRNA shRNA Plasmid DNA
guanine deaminase
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000454178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010266.2-1540s21c1
Sequence:CCGGCCTTGGACATCTGCGACATTCCTCGAGGAATGTCGCAGATGTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-512s1c1
Sequence:CCGGGCTTGCTACTTTGGAACAATTCTCGAGAATTGTTCCAAAGTAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-1364s1c1
Sequence:CCGGGCTGTTATCCAGAAGTTTCTTCTCGAGAAGAAACTTCTGGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-546s1c1
Sequence:CCGGCCCTGATCCTTGCGGAAATTACTCGAGTAATTTCCGCAAGGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-1399s1c1
Sequence:CCGGCCGAAATATTGAGGAGGTTTACTCGAGTAAACCTCCTCAATATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-1142s1c1
Sequence:CCGGGTTTCCAATGTCCTCTTAATTCTCGAGAATTAAGAGGACATTGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010266
GDA MISSION shRNA Lentiviral Transduction Particles
guanine deaminase
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000454178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010266.2-1540s21c1
Sequence:CCGGCCTTGGACATCTGCGACATTCCTCGAGGAATGTCGCAGATGTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-512s1c1
Sequence:CCGGGCTTGCTACTTTGGAACAATTCTCGAGAATTGTTCCAAAGTAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-1364s1c1
Sequence:CCGGGCTGTTATCCAGAAGTTTCTTCTCGAGAAGAAACTTCTGGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-546s1c1
Sequence:CCGGCCCTGATCCTTGCGGAAATTACTCGAGTAATTTCCGCAAGGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-1399s1c1
Sequence:CCGGCCGAAATATTGAGGAGGTTTACTCGAGTAAACCTCCTCAATATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010266.1-1142s1c1
Sequence:CCGGGTTTCCAATGTCCTCTTAATTCTCGAGAATTAAGAGGACATTGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks