EMAIL THIS PAGE TO A FRIEND

GDAP1

ganglioside induced differentiation associated protein 1

119 Gene Product Result for
Synonyms: CMT4 CMT4A CMTRIA
UniProtKB ID: Q8TB36
Gene ID:
Human(54332) Summary: This gene encodes a member of the ganglioside-induced differentiation-associated protein family, which may play a role in a signal transduction pathway during neuronal development. Mutations in this gene have been associated with various forms of Charcot-Marie-Tooth Disease and neuropathy. Two transcript variants encoding different isoforms and a noncoding variant have been identified for this gene. [provided by RefSeq, Feb 2012]
Mouse(14545) ganglioside-induced differentiation-associated-protein 1
Rat(312890) ganglioside-induced differentiation-associated-protein 1
Zebrafish(553702) ganglioside-induced differentiation-associated protein 1
chicken(420191) ganglioside induced differentiation associated protein 1
Thale Cress(825330) golgin candidate 3
cow(613472) ganglioside-induced differentiation-associated protein 1
Horse(100050935) ganglioside induced differentiation associated protein 1
domestic cat(101101612) ganglioside induced differentiation associated protein 1
dog(487002) ganglioside induced differentiation associated protein 1
sheep(101108759) ganglioside induced differentiation associated protein 1
naked mole-rat(101720956) ganglioside induced differentiation associated protein 1
domestic guinea pig(100728585) ganglioside induced differentiation associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018972 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010267 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010267 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010267 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040875 Rosetta Predictions human pricing
NM_018972 Rosetta Predictions human pricing
NM_001107897 Rosetta Predictions rat pricing
XM_232577 Rosetta Predictions rat pricing
NM_010267 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309162 predicted 551
2 SASI_Hs02_00309163 predicted 311
3 SASI_Hs02_00309164 predicted 567
4 SASI_Hs02_00309165 predicted 386
5 SASI_Hs02_00309166 predicted 969
6 SASI_Hs02_00309167 predicted 961
7 SASI_Hs02_00309168 predicted 306
8 SASI_Hs02_00309169 predicted 745
9 SASI_Hs02_00309170 predicted 929
10 SASI_Hs02_00309171 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069684 predicted 709
2 SASI_Hs01_00069685 predicted 481
3 SASI_Hs01_00069686 predicted 732
4 SASI_Hs01_00069687 predicted 548
5 SASI_Hs02_00352453 predicted 1141
6 SASI_Hs01_00069688 predicted 415
7 SASI_Hs02_00352454 predicted 1119
8 SASI_Hs01_00069690 predicted 471
9 SASI_Hs01_00069691 predicted 905
10 SASI_Hs02_00352455 predicted 1091
11 SASI_Hs01_00069682 predicted 337
12 SASI_Hs01_00069683 predicted 325
13 SASI_Hs01_00069689 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233355 predicted 809
2 SASI_Rn02_00233356 predicted 622
3 SASI_Rn02_00233357 predicted 751
4 SASI_Rn02_00233358 predicted 284
5 SASI_Rn02_00233359 predicted 743
6 SASI_Rn02_00233360 predicted 914
7 SASI_Rn02_00233361 predicted 628
8 SASI_Rn02_00233362 predicted 1010
9 SASI_Rn02_00233363 predicted 688
10 SASI_Rn02_00233364 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144947 predicted 919
2 SASI_Rn01_00144948 predicted 912
3 SASI_Rn01_00144949 predicted 1029
4 SASI_Rn01_00144950 predicted 1026
5 SASI_Rn01_00144951 predicted 943
6 SASI_Rn01_00144952 predicted 896
7 SASI_Rn01_00144953 predicted 936
8 SASI_Rn01_00144954 predicted 1028
9 SASI_Rn01_00144955 predicted 937
10 SASI_Rn01_00144956 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146524 predicted 800
2 SASI_Mm01_00146525 predicted 723
3 SASI_Mm01_00146526 predicted 901
4 SASI_Mm01_00146527 predicted 265
5 SASI_Mm01_00146528 predicted 610
6 SASI_Mm01_00146529 predicted 342
7 SASI_Mm01_00146530 predicted 605
8 SASI_Mm01_00146531 predicted 257
9 SASI_Mm01_00146532 predicted 432
10 SASI_Mm01_00146533 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018972
VALIDATED
GDAP1 MISSION shRNA Bacterial Glycerol Stock
ganglioside induced differentiation associated protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-191s1c1
Sequence:CCGGGAGCACAATGAGCCTTGGTTTCTCGAGAAACCAAGGCTCATTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-337s1c1
Sequence:CCGGGCCTGATAAAGAAAGCATGTACTCGAGTACATGCTTTCTTTATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-578s1c1
Sequence:CCGGCGACTTAAATCAAAGCTGCTTCTCGAGAAGCAGCTTTGATTTAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-825s1c1
Sequence:CCGGGACCAAACTTGGAAACCTATTCTCGAGAATAGGTTTCCAAGTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-275s1c1
Sequence:CCGGGCCACTCAGATCATTGATTATCTCGAGATAATCAATGATCTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-326s1c1
Sequence:CCGGCCCAGGTTAATGCCTGATAAACTCGAGTTTATCAGGCATTAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-824s1c1
Sequence:CCGGCGACCAAACTTGGAAACCTATCTCGAGATAGGTTTCCAAGTTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-410s1c1
Sequence:CCGGGCCTATACACATGGCTGCATTCTCGAGAATGCAGCCATGTGTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018972.1-581s1c1
Sequence:CCGGCTTAAATCAAAGCTGCTTGATCTCGAGATCAAGCAGCTTTGATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018972
VALIDATED
GDAP1 MISSION shRNA shRNA Plasmid DNA
ganglioside induced differentiation associated protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-191s1c1
Sequence:CCGGGAGCACAATGAGCCTTGGTTTCTCGAGAAACCAAGGCTCATTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-337s1c1
Sequence:CCGGGCCTGATAAAGAAAGCATGTACTCGAGTACATGCTTTCTTTATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-578s1c1
Sequence:CCGGCGACTTAAATCAAAGCTGCTTCTCGAGAAGCAGCTTTGATTTAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-825s1c1
Sequence:CCGGGACCAAACTTGGAAACCTATTCTCGAGAATAGGTTTCCAAGTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-275s1c1
Sequence:CCGGGCCACTCAGATCATTGATTATCTCGAGATAATCAATGATCTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-326s1c1
Sequence:CCGGCCCAGGTTAATGCCTGATAAACTCGAGTTTATCAGGCATTAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-824s1c1
Sequence:CCGGCGACCAAACTTGGAAACCTATCTCGAGATAGGTTTCCAAGTTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-410s1c1
Sequence:CCGGGCCTATACACATGGCTGCATTCTCGAGAATGCAGCCATGTGTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018972.1-581s1c1
Sequence:CCGGCTTAAATCAAAGCTGCTTGATCTCGAGATCAAGCAGCTTTGATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018972
VALIDATED
GDAP1 MISSION shRNA Lentiviral Transduction Particles
ganglioside induced differentiation associated protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-191s1c1
Sequence:CCGGGAGCACAATGAGCCTTGGTTTCTCGAGAAACCAAGGCTCATTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-337s1c1
Sequence:CCGGGCCTGATAAAGAAAGCATGTACTCGAGTACATGCTTTCTTTATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-578s1c1
Sequence:CCGGCGACTTAAATCAAAGCTGCTTCTCGAGAAGCAGCTTTGATTTAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-825s1c1
Sequence:CCGGGACCAAACTTGGAAACCTATTCTCGAGAATAGGTTTCCAAGTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-275s1c1
Sequence:CCGGGCCACTCAGATCATTGATTATCTCGAGATAATCAATGATCTGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-326s1c1
Sequence:CCGGCCCAGGTTAATGCCTGATAAACTCGAGTTTATCAGGCATTAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-824s1c1
Sequence:CCGGCGACCAAACTTGGAAACCTATCTCGAGATAGGTTTCCAAGTTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018972.1-410s1c1
Sequence:CCGGGCCTATACACATGGCTGCATTCTCGAGAATGCAGCCATGTGTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018972.1-581s1c1
Sequence:CCGGCTTAAATCAAAGCTGCTTGATCTCGAGATCAAGCAGCTTTGATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010267
GDAP1 MISSION shRNA Bacterial Glycerol Stock
ganglioside induced differentiation associated protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010267.2-408s1c1
Sequence:CCGGCGATGAAGGAAGCATGTATTACTCGAGTAATACATGCTTCCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010267.2-799s1c1
Sequence:CCGGGAATCCTTTACACTGGCAGATCTCGAGATCTGCCAGTGTAAAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010267.2-1059s1c1
Sequence:CCGGGCTTGTAGGAATGGGATATTTCTCGAGAAATATCCCATTCCTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010267.2-343s1c1
Sequence:CCGGGCCACTCAGATCATTGATTATCTCGAGATAATCAATGATCTGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010267.2-895s1c1
Sequence:CCGGCCGAACTTGGAAACCTATTATCTCGAGATAATAGGTTTCCAAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010267.2-2477s1c1
Sequence:CCGGGAATAGCCATCAGACTATAATCTCGAGATTATAGTCTGATGGCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010267.2-667s1c1
Sequence:CCGGGATCATGACAATGTCAAATACCTCGAGGTATTTGACATTGTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010267
GDAP1 MISSION shRNA shRNA Plasmid DNA
ganglioside induced differentiation associated protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010267.2-408s1c1
Sequence:CCGGCGATGAAGGAAGCATGTATTACTCGAGTAATACATGCTTCCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010267.2-799s1c1
Sequence:CCGGGAATCCTTTACACTGGCAGATCTCGAGATCTGCCAGTGTAAAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010267.2-1059s1c1
Sequence:CCGGGCTTGTAGGAATGGGATATTTCTCGAGAAATATCCCATTCCTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010267.2-343s1c1
Sequence:CCGGGCCACTCAGATCATTGATTATCTCGAGATAATCAATGATCTGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010267.2-895s1c1
Sequence:CCGGCCGAACTTGGAAACCTATTATCTCGAGATAATAGGTTTCCAAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010267.2-2477s1c1
Sequence:CCGGGAATAGCCATCAGACTATAATCTCGAGATTATAGTCTGATGGCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010267.2-667s1c1
Sequence:CCGGGATCATGACAATGTCAAATACCTCGAGGTATTTGACATTGTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010267
GDAP1 MISSION shRNA Lentiviral Transduction Particles
ganglioside induced differentiation associated protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010267.2-408s1c1
Sequence:CCGGCGATGAAGGAAGCATGTATTACTCGAGTAATACATGCTTCCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010267.2-799s1c1
Sequence:CCGGGAATCCTTTACACTGGCAGATCTCGAGATCTGCCAGTGTAAAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010267.2-1059s1c1
Sequence:CCGGGCTTGTAGGAATGGGATATTTCTCGAGAAATATCCCATTCCTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010267.2-343s1c1
Sequence:CCGGGCCACTCAGATCATTGATTATCTCGAGATAATCAATGATCTGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010267.2-895s1c1
Sequence:CCGGCCGAACTTGGAAACCTATTATCTCGAGATAATAGGTTTCCAAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010267.2-2477s1c1
Sequence:CCGGGAATAGCCATCAGACTATAATCTCGAGATTATAGTCTGATGGCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010267.2-667s1c1
Sequence:CCGGGATCATGACAATGTCAAATACCTCGAGGTATTTGACATTGTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks