EMAIL THIS PAGE TO A FRIEND

GDAP1L1

ganglioside induced differentiation associated protein 1-like 1

103 Gene Product Result for
Synonyms: dJ881L22.1 dJ995J12.1.1
Gene ID:
Human(78997) Summary: The ganglioside GD3 synthase causes cell differentiation with neurite sprouting when transfected into the mouse neuroblastoma cell line Neuro2a. After differentiation, the expression of several genes is upregulated, including one that encodes a protein termed ganglioside-induced differentiation-associated protein 1 (Gdap1). A similar gene was found in humans, and mutations in the human gene are associated with Charcot-Marie-Tooth type 4A disease. The protein encoded by this gene is similar in sequence to the human GDAP1 protein. Several transcript variants encoding different isoforms, as well as a noncoding transcript variant, have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(228858) ganglioside-induced differentiation-associated protein 1-like 1
Rat(311616) ganglioside-induced differentiation-associated protein 1-like 1
sheep(101105842) ganglioside induced differentiation associated protein 1-like 1
domestic guinea pig(100712734) ganglioside induced differentiation associated protein 1-like 1
naked mole-rat(101711728) ganglioside induced differentiation associated protein 1-like 1
Zebrafish(562163) ganglioside-induced differentiation-associated protein 1-like 1
chicken(419201) ganglioside induced differentiation associated protein 1-like 1
dog(485881) ganglioside induced differentiation associated protein 1-like 1
domestic cat(101093765) ganglioside induced differentiation associated protein 1-like 1
cow(541158) ganglioside-induced differentiation-associated protein 1-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100909 Anti-GDAP1L1 antibody produced in rabbit affinity isolated antibody mouse, bovine, rabbit, rat, canine, zebrafish, guinea pig, human, horse
western blot pricing
HPA063265 Anti-GDAP1L1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024034 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067141 MISSION® esiRNA esiRNA human GDAP1L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024034 Rosetta Predictions human pricing
NM_001107798 Rosetta Predictions rat pricing
NM_144891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240806 predicted 595
2 SASI_Hs01_00240807 predicted 983
3 SASI_Hs01_00240808 predicted 389
4 SASI_Hs01_00240809 predicted 372
5 SASI_Hs01_00240810 predicted 524
6 SASI_Hs01_00240811 predicted 622
7 SASI_Hs01_00240812 predicted 642
8 SASI_Hs01_00240813 predicted 1610
9 SASI_Hs01_00240814 predicted 541
10 SASI_Hs01_00240815 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232375 predicted 665
2 SASI_Rn02_00232376 predicted 287
3 SASI_Rn02_00232377 predicted 620
4 SASI_Rn02_00232378 predicted 225
5 SASI_Rn02_00232379 predicted 649
6 SASI_Rn02_00232380 predicted 835
7 SASI_Rn02_00232381 predicted 238
8 SASI_Rn02_00232382 predicted 890
9 SASI_Rn02_00232383 predicted 644
10 SASI_Rn02_00232384 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340340 predicted 1230
2 SASI_Mm02_00340341 predicted 1359
3 SASI_Mm01_00106043 predicted 614
4 SASI_Mm02_00340342 predicted 1296
5 SASI_Mm02_00340343 predicted 1321
6 SASI_Mm02_00340344 predicted 383
7 SASI_Mm02_00340345 predicted 1246
8 SASI_Mm02_00340346 predicted 1316
9 SASI_Mm02_00340347 predicted 400
10 SASI_Mm02_00340348 predicted 1294
11 SASI_Mm01_00106042 predicted 365
12 SASI_Mm01_00106044 predicted 389
13 SASI_Mm01_00106045 predicted 233
14 SASI_Mm01_00106046 predicted 353
15 SASI_Mm01_00106047 predicted 779
16 SASI_Mm01_00106048 predicted 645
17 SASI_Mm01_00106049 predicted 966
18 SASI_Mm01_00106050 predicted 342
19 SASI_Mm01_00106051 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144891
GDAP1L1 MISSION shRNA Bacterial Glycerol Stock
ganglioside induced differentiation associated protein 1-like 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144891.2-998s21c1
Sequence:CCGGAGACGCTTTGCCTTCCGGAAACTCGAGTTTCCGGAAGGCAAAGCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144891.2-381s21c1
Sequence:CCGGTTATCCACAGAGACAACATTACTCGAGTAATGTTGTCTCTGTGGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144891.2-1582s21c1
Sequence:CCGGGACCTCTTCTATAGGACAAAGCTCGAGCTTTGTCCTATAGAAGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144891.2-1348s21c1
Sequence:CCGGACATTGTCAACGCCGTGATTTCTCGAGAAATCACGGCGTTGACAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144891.2-1320s21c1
Sequence:CCGGGTGACAACATTCCATAGTTTACTCGAGTAAACTATGGAATGTTGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144891.1-401s1c1
Sequence:CCGGCAGTGACTATGACCAGATCATCTCGAGATGATCTGGTCATAGTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144891.1-575s1c1
Sequence:CCGGGCTCACCACAGATTCCATGATCTCGAGATCATGGAATCTGTGGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144891.1-612s1c1
Sequence:CCGGGCTGAGATCCGCAGACATTTACTCGAGTAAATGTCTGCGGATCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144891.1-326s1c1
Sequence:CCGGGCATAAGGAACCGTGGTTCATCTCGAGATGAACCACGGTTCCTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144891.1-749s1c1
Sequence:CCGGGAGCTACCTGAAGAAGATCCTCTCGAGAGGATCTTCTTCAGGTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144891.1-923s1c1
Sequence:CCGGCCTGGGACTGTCCAAGAAATACTCGAGTATTTCTTGGACAGTCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144891
GDAP1L1 MISSION shRNA shRNA Plasmid DNA
ganglioside induced differentiation associated protein 1-like 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144891.2-998s21c1
Sequence:CCGGAGACGCTTTGCCTTCCGGAAACTCGAGTTTCCGGAAGGCAAAGCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144891.2-381s21c1
Sequence:CCGGTTATCCACAGAGACAACATTACTCGAGTAATGTTGTCTCTGTGGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144891.2-1582s21c1
Sequence:CCGGGACCTCTTCTATAGGACAAAGCTCGAGCTTTGTCCTATAGAAGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144891.2-1348s21c1
Sequence:CCGGACATTGTCAACGCCGTGATTTCTCGAGAAATCACGGCGTTGACAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144891.2-1320s21c1
Sequence:CCGGGTGACAACATTCCATAGTTTACTCGAGTAAACTATGGAATGTTGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144891.1-401s1c1
Sequence:CCGGCAGTGACTATGACCAGATCATCTCGAGATGATCTGGTCATAGTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144891.1-575s1c1
Sequence:CCGGGCTCACCACAGATTCCATGATCTCGAGATCATGGAATCTGTGGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144891.1-612s1c1
Sequence:CCGGGCTGAGATCCGCAGACATTTACTCGAGTAAATGTCTGCGGATCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144891.1-326s1c1
Sequence:CCGGGCATAAGGAACCGTGGTTCATCTCGAGATGAACCACGGTTCCTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144891.1-749s1c1
Sequence:CCGGGAGCTACCTGAAGAAGATCCTCTCGAGAGGATCTTCTTCAGGTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144891.1-923s1c1
Sequence:CCGGCCTGGGACTGTCCAAGAAATACTCGAGTATTTCTTGGACAGTCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144891
GDAP1L1 MISSION shRNA Lentiviral Transduction Particles
ganglioside induced differentiation associated protein 1-like 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144891.2-998s21c1
Sequence:CCGGAGACGCTTTGCCTTCCGGAAACTCGAGTTTCCGGAAGGCAAAGCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144891.2-381s21c1
Sequence:CCGGTTATCCACAGAGACAACATTACTCGAGTAATGTTGTCTCTGTGGATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144891.2-1582s21c1
Sequence:CCGGGACCTCTTCTATAGGACAAAGCTCGAGCTTTGTCCTATAGAAGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144891.2-1348s21c1
Sequence:CCGGACATTGTCAACGCCGTGATTTCTCGAGAAATCACGGCGTTGACAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144891.2-1320s21c1
Sequence:CCGGGTGACAACATTCCATAGTTTACTCGAGTAAACTATGGAATGTTGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144891.1-401s1c1
Sequence:CCGGCAGTGACTATGACCAGATCATCTCGAGATGATCTGGTCATAGTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144891.1-575s1c1
Sequence:CCGGGCTCACCACAGATTCCATGATCTCGAGATCATGGAATCTGTGGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144891.1-612s1c1
Sequence:CCGGGCTGAGATCCGCAGACATTTACTCGAGTAAATGTCTGCGGATCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144891.1-326s1c1
Sequence:CCGGGCATAAGGAACCGTGGTTCATCTCGAGATGAACCACGGTTCCTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144891.1-749s1c1
Sequence:CCGGGAGCTACCTGAAGAAGATCCTCTCGAGAGGATCTTCTTCAGGTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144891.1-923s1c1
Sequence:CCGGCCTGGGACTGTCCAAGAAATACTCGAGTATTTCTTGGACAGTCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024034
GDAP1L1 MISSION shRNA Bacterial Glycerol Stock
ganglioside induced differentiation associated protein 1-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024034.3-1592s21c1
Sequence:CCGGGAACTCTTCCACAGGACAAAGCTCGAGCTTTGTCCTGTGGAAGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024034.3-392s21c1
Sequence:CCGGAGTGACTATGACCAGATCATTCTCGAGAATGATCTGGTCATAGTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024034.3-988s21c1
Sequence:CCGGACGCTTTGCCTTCCGGAAAGTCTCGAGACTTTCCGGAAGGCAAAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024034.3-612s1c1
Sequence:CCGGGCAGACATTTAGCCAATGCCACTCGAGTGGCATTGGCTAAATGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024034.3-1280s1c1
Sequence:CCGGCCCTTCGTTCTGAGTAATAATCTCGAGATTATTACTCAGAACGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024034.3-955s1c1
Sequence:CCGGCAACCTGCAGTCCTTCTTTGACTCGAGTCAAAGAAGGACTGCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024034.3-1322s1c1
Sequence:CCGGCGTAGTTTAGAAGTAGACGTTCTCGAGAACGTCTACTTCTAAACTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024034.3-397s1c1
Sequence:CCGGCTATGACCAGATCATTGACTACTCGAGTAGTCAATGATCTGGTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024034.3-2018s1c1
Sequence:CCGGCCAAGCCATCTCCTTCAATATCTCGAGATATTGAAGGAGATGGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024034
GDAP1L1 MISSION shRNA shRNA Plasmid DNA
ganglioside induced differentiation associated protein 1-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024034.3-1592s21c1
Sequence:CCGGGAACTCTTCCACAGGACAAAGCTCGAGCTTTGTCCTGTGGAAGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024034.3-392s21c1
Sequence:CCGGAGTGACTATGACCAGATCATTCTCGAGAATGATCTGGTCATAGTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024034.3-988s21c1
Sequence:CCGGACGCTTTGCCTTCCGGAAAGTCTCGAGACTTTCCGGAAGGCAAAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024034.3-612s1c1
Sequence:CCGGGCAGACATTTAGCCAATGCCACTCGAGTGGCATTGGCTAAATGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024034.3-1280s1c1
Sequence:CCGGCCCTTCGTTCTGAGTAATAATCTCGAGATTATTACTCAGAACGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024034.3-955s1c1
Sequence:CCGGCAACCTGCAGTCCTTCTTTGACTCGAGTCAAAGAAGGACTGCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024034.3-1322s1c1
Sequence:CCGGCGTAGTTTAGAAGTAGACGTTCTCGAGAACGTCTACTTCTAAACTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024034.3-397s1c1
Sequence:CCGGCTATGACCAGATCATTGACTACTCGAGTAGTCAATGATCTGGTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024034.3-2018s1c1
Sequence:CCGGCCAAGCCATCTCCTTCAATATCTCGAGATATTGAAGGAGATGGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024034
GDAP1L1 MISSION shRNA Lentiviral Transduction Particles
ganglioside induced differentiation associated protein 1-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024034.3-1592s21c1
Sequence:CCGGGAACTCTTCCACAGGACAAAGCTCGAGCTTTGTCCTGTGGAAGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024034.3-392s21c1
Sequence:CCGGAGTGACTATGACCAGATCATTCTCGAGAATGATCTGGTCATAGTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024034.3-988s21c1
Sequence:CCGGACGCTTTGCCTTCCGGAAAGTCTCGAGACTTTCCGGAAGGCAAAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024034.3-612s1c1
Sequence:CCGGGCAGACATTTAGCCAATGCCACTCGAGTGGCATTGGCTAAATGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024034.3-1280s1c1
Sequence:CCGGCCCTTCGTTCTGAGTAATAATCTCGAGATTATTACTCAGAACGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024034.3-955s1c1
Sequence:CCGGCAACCTGCAGTCCTTCTTTGACTCGAGTCAAAGAAGGACTGCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024034.3-1322s1c1
Sequence:CCGGCGTAGTTTAGAAGTAGACGTTCTCGAGAACGTCTACTTCTAAACTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024034.3-397s1c1
Sequence:CCGGCTATGACCAGATCATTGACTACTCGAGTAGTCAATGATCTGGTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024034.3-2018s1c1
Sequence:CCGGCCAAGCCATCTCCTTCAATATCTCGAGATATTGAAGGAGATGGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)