EMAIL THIS PAGE TO A FRIEND

GDAP2

ganglioside induced differentiation associated protein 2

182 Gene Product Result for
Synonyms: MACROD3 dJ776P7.1
UniProtKB ID: Q9NXN4, Q96DZ0
Gene ID:
Mouse(14547) ganglioside-induced differentiation-associated-protein 2
Rat(362004) ganglioside-induced differentiation-associated-protein 2
Zebrafish(447824) ganglioside induced differentiation associated protein 2
chicken(425913) ganglioside induced differentiation associated protein 2
cow(508774) ganglioside induced differentiation associated protein 2
Horse(100059781) ganglioside induced differentiation associated protein 2
domestic cat(101087507) ganglioside induced differentiation associated protein 2
dog(475812) ganglioside induced differentiation associated protein 2
naked mole-rat(101701993) ganglioside induced differentiation associated protein 2
domestic guinea pig(100713521) ganglioside induced differentiation associated protein 2
sheep(101108971) ganglioside induced differentiation associated protein 2
Domestic Rabbit(100356984) ganglioside induced differentiation associated protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017686 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017686 Rosetta Predictions human pricing
NM_001013201 Rosetta Predictions rat pricing
NM_010269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226609 predicted 743
2 SASI_Hs01_00226610 predicted 904
3 SASI_Hs01_00226611 predicted 722
4 SASI_Hs01_00226612 predicted 1192
5 SASI_Hs02_00350438 predicted 1432
6 SASI_Hs01_00226613 predicted 1348
7 SASI_Hs01_00226614 predicted 679
8 SASI_Hs01_00226616 predicted 424
9 SASI_Hs01_00226617 predicted 955
10 SASI_Hs01_00226618 predicted 1346
11 SASI_Hs01_00226615 predicted 1591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100588 predicted 1433
2 SASI_Rn01_00100589 predicted 1468
3 SASI_Rn01_00100590 predicted 1204
4 SASI_Rn01_00100591 predicted 386
5 SASI_Rn01_00100592 predicted 1312
6 SASI_Rn01_00100593 predicted 731
7 SASI_Rn01_00100594 predicted 1168
8 SASI_Rn02_00200976 predicted 1370
9 SASI_Rn01_00100595 predicted 969
10 SASI_Rn01_00100596 predicted 284
11 SASI_Rn01_00100597 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044199 predicted 967
2 SASI_Mm01_00044200 predicted 1332
3 SASI_Mm01_00044202 predicted 1463
4 SASI_Mm01_00044203 predicted 392
5 SASI_Mm01_00044204 predicted 915
6 SASI_Mm01_00044205 predicted 283
7 SASI_Mm02_00318181 predicted 729
8 SASI_Mm01_00044206 predicted 1364
9 SASI_Mm01_00044207 predicted 1243
10 SASI_Mm01_00044208 predicted 1189
11 SASI_Mm01_00044201 predicted 1214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017686
VALIDATED
GDAP2 MISSION shRNA Bacterial Glycerol Stock
ganglioside induced differentiation associated protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017686.1-2666s1c1
Sequence:CCGGGCTCTATTTGTGCCTTAGCTTCTCGAGAAGCTAAGGCACAAATAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017686.1-1631s1c1
Sequence:CCGGCTTGAATATGATGCCAGGGAACTCGAGTTCCCTGGCATCATATTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017686.1-1630s1c1
Sequence:CCGGCCTTGAATATGATGCCAGGGACTCGAGTCCCTGGCATCATATTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140906    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017686.1-2716s1c1
Sequence:CCGGCCTACCTCACAGAGGTATCATCTCGAGATGATACCTCTGTGAGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017686.1-761s1c1
Sequence:CCGGCGCACTGTAAGAAGATTCCTACTCGAGTAGGAATCTTCTTACAGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017686.1-1064s1c1
Sequence:CCGGGCTCGAATGGAAGGAGATATTCTCGAGAATATCTCCTTCCATTCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017686.1-1217s1c1
Sequence:CCGGGCCTTATACCAAACAGGTGTTCTCGAGAACACCTGTTTGGTATAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017686.1-953s1c1
Sequence:CCGGCCTGAACGACAGATTAGAATACTCGAGTATTCTAATCTGTCGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121730    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017686.1-2434s1c1
Sequence:CCGGCGCACATATTAGTACTCTTAACTCGAGTTAAGAGTACTAATATGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017686.1-1442s1c1
Sequence:CCGGGATGTCAAGTACAAGAGGAATCTCGAGATTCCTCTTGTACTTGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017686.1-651s1c1
Sequence:CCGGGAAACGTACTTCAACTAGCAACTCGAGTTGCTAGTTGAAGTACGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017686.1-2433s1c1
Sequence:CCGGCCGCACATATTAGTACTCTTACTCGAGTAAGAGTACTAATATGTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017686
VALIDATED
GDAP2 MISSION shRNA shRNA Plasmid DNA
ganglioside induced differentiation associated protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017686.1-2666s1c1
Sequence:CCGGGCTCTATTTGTGCCTTAGCTTCTCGAGAAGCTAAGGCACAAATAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017686.1-1631s1c1
Sequence:CCGGCTTGAATATGATGCCAGGGAACTCGAGTTCCCTGGCATCATATTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017686.1-1630s1c1
Sequence:CCGGCCTTGAATATGATGCCAGGGACTCGAGTCCCTGGCATCATATTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140906    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017686.1-2716s1c1
Sequence:CCGGCCTACCTCACAGAGGTATCATCTCGAGATGATACCTCTGTGAGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017686.1-761s1c1
Sequence:CCGGCGCACTGTAAGAAGATTCCTACTCGAGTAGGAATCTTCTTACAGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017686.1-1064s1c1
Sequence:CCGGGCTCGAATGGAAGGAGATATTCTCGAGAATATCTCCTTCCATTCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017686.1-1217s1c1
Sequence:CCGGGCCTTATACCAAACAGGTGTTCTCGAGAACACCTGTTTGGTATAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017686.1-953s1c1
Sequence:CCGGCCTGAACGACAGATTAGAATACTCGAGTATTCTAATCTGTCGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121730    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017686.1-2434s1c1
Sequence:CCGGCGCACATATTAGTACTCTTAACTCGAGTTAAGAGTACTAATATGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017686.1-1442s1c1
Sequence:CCGGGATGTCAAGTACAAGAGGAATCTCGAGATTCCTCTTGTACTTGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017686.1-651s1c1
Sequence:CCGGGAAACGTACTTCAACTAGCAACTCGAGTTGCTAGTTGAAGTACGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017686.1-2433s1c1
Sequence:CCGGCCGCACATATTAGTACTCTTACTCGAGTAAGAGTACTAATATGTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017686
VALIDATED
GDAP2 MISSION shRNA Lentiviral Transduction Particles
ganglioside induced differentiation associated protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017686.1-2666s1c1
Sequence:CCGGGCTCTATTTGTGCCTTAGCTTCTCGAGAAGCTAAGGCACAAATAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017686.1-1631s1c1
Sequence:CCGGCTTGAATATGATGCCAGGGAACTCGAGTTCCCTGGCATCATATTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017686.1-1630s1c1
Sequence:CCGGCCTTGAATATGATGCCAGGGACTCGAGTCCCTGGCATCATATTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140906    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017686.1-2716s1c1
Sequence:CCGGCCTACCTCACAGAGGTATCATCTCGAGATGATACCTCTGTGAGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017686.1-761s1c1
Sequence:CCGGCGCACTGTAAGAAGATTCCTACTCGAGTAGGAATCTTCTTACAGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017686.1-1064s1c1
Sequence:CCGGGCTCGAATGGAAGGAGATATTCTCGAGAATATCTCCTTCCATTCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017686.1-1217s1c1
Sequence:CCGGGCCTTATACCAAACAGGTGTTCTCGAGAACACCTGTTTGGTATAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017686.1-953s1c1
Sequence:CCGGCCTGAACGACAGATTAGAATACTCGAGTATTCTAATCTGTCGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121730    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017686.1-2434s1c1
Sequence:CCGGCGCACATATTAGTACTCTTAACTCGAGTTAAGAGTACTAATATGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017686.1-1442s1c1
Sequence:CCGGGATGTCAAGTACAAGAGGAATCTCGAGATTCCTCTTGTACTTGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017686.1-651s1c1
Sequence:CCGGGAAACGTACTTCAACTAGCAACTCGAGTTGCTAGTTGAAGTACGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017686.1-2433s1c1
Sequence:CCGGCCGCACATATTAGTACTCTTACTCGAGTAAGAGTACTAATATGTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010269
VALIDATED
GDAP2 MISSION shRNA Bacterial Glycerol Stock
ganglioside induced differentiation associated protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010269.1-274s1c1
Sequence:CCGGGACTCGTACGAAGATGAAGTACTCGAGTACTTCATCTTCGTACGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010269.1-577s1c1
Sequence:CCGGGCTCGGTTCATCATTCACACACTCGAGTGTGTGAATGATGAACCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010269.1-733s1c1
Sequence:CCGGCGAGGTTATCCACTAGAAGATCTCGAGATCTTCTAGTGGATAACCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010269.1-969s1c1
Sequence:CCGGGCGGCAAATTAGAATCAGTGACTCGAGTCACTGATTCTAATTTGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010269.2-968s21c1
Sequence:CCGGGCGGCAAATTAGAATCAGTGACTCGAGTCACTGATTCTAATTTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010269.2-732s21c1
Sequence:CCGGCGAGGTTATCCACTAGAAGATCTCGAGATCTTCTAGTGGATAACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010269.2-273s21c1
Sequence:CCGGGACTCGTACGAAGATGAAGTACTCGAGTACTTCATCTTCGTACGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010269.2-576s21c1
Sequence:CCGGGCTCGGTTCATCATTCACACACTCGAGTGTGTGAATGATGAACCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010269
VALIDATED
GDAP2 MISSION shRNA shRNA Plasmid DNA
ganglioside induced differentiation associated protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010269.1-274s1c1
Sequence:CCGGGACTCGTACGAAGATGAAGTACTCGAGTACTTCATCTTCGTACGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010269.1-577s1c1
Sequence:CCGGGCTCGGTTCATCATTCACACACTCGAGTGTGTGAATGATGAACCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010269.1-733s1c1
Sequence:CCGGCGAGGTTATCCACTAGAAGATCTCGAGATCTTCTAGTGGATAACCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010269.1-969s1c1
Sequence:CCGGGCGGCAAATTAGAATCAGTGACTCGAGTCACTGATTCTAATTTGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010269.2-968s21c1
Sequence:CCGGGCGGCAAATTAGAATCAGTGACTCGAGTCACTGATTCTAATTTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010269.2-732s21c1
Sequence:CCGGCGAGGTTATCCACTAGAAGATCTCGAGATCTTCTAGTGGATAACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010269.2-273s21c1
Sequence:CCGGGACTCGTACGAAGATGAAGTACTCGAGTACTTCATCTTCGTACGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010269.2-576s21c1
Sequence:CCGGGCTCGGTTCATCATTCACACACTCGAGTGTGTGAATGATGAACCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010269
VALIDATED
GDAP2 MISSION shRNA Lentiviral Transduction Particles
ganglioside induced differentiation associated protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010269.1-274s1c1
Sequence:CCGGGACTCGTACGAAGATGAAGTACTCGAGTACTTCATCTTCGTACGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010269.1-577s1c1
Sequence:CCGGGCTCGGTTCATCATTCACACACTCGAGTGTGTGAATGATGAACCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010269.1-733s1c1
Sequence:CCGGCGAGGTTATCCACTAGAAGATCTCGAGATCTTCTAGTGGATAACCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010269.1-969s1c1
Sequence:CCGGGCGGCAAATTAGAATCAGTGACTCGAGTCACTGATTCTAATTTGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010269.2-968s21c1
Sequence:CCGGGCGGCAAATTAGAATCAGTGACTCGAGTCACTGATTCTAATTTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010269.2-732s21c1
Sequence:CCGGCGAGGTTATCCACTAGAAGATCTCGAGATCTTCTAGTGGATAACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010269.2-273s21c1
Sequence:CCGGGACTCGTACGAAGATGAAGTACTCGAGTACTTCATCTTCGTACGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010269.2-576s21c1
Sequence:CCGGGCTCGGTTCATCATTCACACACTCGAGTGTGTGAATGATGAACCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)