EMAIL THIS PAGE TO A FRIEND

GDE1

glycerophosphodiester phosphodiesterase 1

96 Gene Product Result for
Synonyms: 363E6.2 MIR16
UniProtKB ID: Q9NZC3, O43334, Q6PKF7, Q7KYR4
Gene ID:
Mouse(56209) glycerophosphodiester phosphodiesterase 1
Rat(60418) glycerophosphodiester phosphodiesterase 1
sheep(101117209) glycerophosphodiester phosphodiesterase 1
domestic guinea pig(100734943) glycerophosphodiester phosphodiesterase 1
naked mole-rat(101701542) glycerophosphodiester phosphodiesterase 1
Zebrafish(393213) glycerophosphodiester phosphodiesterase 1
cow(539978) glycerophosphodiester phosphodiesterase 1
domestic cat(101085681) glycerophosphodiester phosphodiesterase 1
dog(479827) glycerophosphodiester phosphodiesterase 1
chicken(416612) glycerophosphodiester phosphodiesterase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016641 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016641 Rosetta Predictions human pricing
NM_032615 Rosetta Predictions rat pricing
NM_019580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057513 predicted 1194
2 SASI_Hs01_00057514 predicted 880
3 SASI_Hs01_00057515 predicted 532
4 SASI_Hs01_00057516 predicted 1077
5 SASI_Hs01_00057517 predicted 850
6 SASI_Hs01_00057518 predicted 463
7 SASI_Hs01_00057519 predicted 799
8 SASI_Hs02_00349808 predicted 348
9 SASI_Hs01_00057520 predicted 874
10 SASI_Hs01_00057521 predicted 1152
11 SASI_Hs01_00057522 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052828 predicted 514
2 SASI_Rn01_00052829 predicted 1190
3 SASI_Rn02_00265483 predicted 491
4 SASI_Rn01_00052830 predicted 973
5 SASI_Rn01_00052831 predicted 1177
6 SASI_Rn01_00052832 predicted 415
7 SASI_Rn01_00052834 predicted 521
8 SASI_Rn01_00052835 predicted 588
9 SASI_Rn01_00052836 predicted 991
10 SASI_Rn01_00052837 predicted 1173
11 SASI_Rn01_00052833 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022735 predicted 829
2 SASI_Mm01_00022736 predicted 520
3 SASI_Mm01_00022737 predicted 658
4 SASI_Mm01_00022738 predicted 403
5 SASI_Mm01_00022739 predicted 973
6 SASI_Mm01_00022740 predicted 460
7 SASI_Mm01_00022741 predicted 1171
8 SASI_Mm01_00022742 predicted 505
9 SASI_Mm01_00022743 predicted 378
10 SASI_Mm01_00022744 predicted 1128
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016641
VALIDATED
GDE1 MISSION shRNA Bacterial Glycerol Stock
glycerophosphodiester phosphodiesterase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016641.3-782s21c1
Sequence:CCGGGCCAGAAGTTATCTACAAGATCTCGAGATCTTGTAGATAACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016641.3-882s21c1
Sequence:CCGGCGCTATGATACTTTCTGGAAACTCGAGTTTCCAGAAAGTATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016641.3-590s21c1
Sequence:CCGGCCACAGACTCAGGAATGATTTCTCGAGAAATCATTCCTGAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016641.3-1506s21c1
Sequence:CCGGGATAACTCAGAGTTGACATTTCTCGAGAAATGTCAACTCTGAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016641.3-1101s21c1
Sequence:CCGGCATCTTGGTTCCAGCTATATCCTCGAGGATATAGCTGGAACCAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-2488s1c1
Sequence:CCGGCCTCACTGAATCTGCCTTTATCTCGAGATAAAGGCAGATTCAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-590s1c1
Sequence:CCGGCCACAGACTCAGGAATGATTTCTCGAGAAATCATTCCTGAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-881s1c1
Sequence:CCGGACGCTATGATACTTTCTGGAACTCGAGTTCCAGAAAGTATCATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-782s1c1
Sequence:CCGGGCCAGAAGTTATCTACAAGATCTCGAGATCTTGTAGATAACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-882s1c1
Sequence:CCGGCGCTATGATACTTTCTGGAAACTCGAGTTTCCAGAAAGTATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016641
VALIDATED
GDE1 MISSION shRNA shRNA Plasmid DNA
glycerophosphodiester phosphodiesterase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016641.3-782s21c1
Sequence:CCGGGCCAGAAGTTATCTACAAGATCTCGAGATCTTGTAGATAACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016641.3-882s21c1
Sequence:CCGGCGCTATGATACTTTCTGGAAACTCGAGTTTCCAGAAAGTATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016641.3-590s21c1
Sequence:CCGGCCACAGACTCAGGAATGATTTCTCGAGAAATCATTCCTGAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016641.3-1506s21c1
Sequence:CCGGGATAACTCAGAGTTGACATTTCTCGAGAAATGTCAACTCTGAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016641.3-1101s21c1
Sequence:CCGGCATCTTGGTTCCAGCTATATCCTCGAGGATATAGCTGGAACCAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-2488s1c1
Sequence:CCGGCCTCACTGAATCTGCCTTTATCTCGAGATAAAGGCAGATTCAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-590s1c1
Sequence:CCGGCCACAGACTCAGGAATGATTTCTCGAGAAATCATTCCTGAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-881s1c1
Sequence:CCGGACGCTATGATACTTTCTGGAACTCGAGTTCCAGAAAGTATCATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-782s1c1
Sequence:CCGGGCCAGAAGTTATCTACAAGATCTCGAGATCTTGTAGATAACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-882s1c1
Sequence:CCGGCGCTATGATACTTTCTGGAAACTCGAGTTTCCAGAAAGTATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016641
VALIDATED
GDE1 MISSION shRNA Lentiviral Transduction Particles
glycerophosphodiester phosphodiesterase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016641.3-782s21c1
Sequence:CCGGGCCAGAAGTTATCTACAAGATCTCGAGATCTTGTAGATAACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016641.3-882s21c1
Sequence:CCGGCGCTATGATACTTTCTGGAAACTCGAGTTTCCAGAAAGTATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016641.3-590s21c1
Sequence:CCGGCCACAGACTCAGGAATGATTTCTCGAGAAATCATTCCTGAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016641.3-1506s21c1
Sequence:CCGGGATAACTCAGAGTTGACATTTCTCGAGAAATGTCAACTCTGAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016641.3-1101s21c1
Sequence:CCGGCATCTTGGTTCCAGCTATATCCTCGAGGATATAGCTGGAACCAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-2488s1c1
Sequence:CCGGCCTCACTGAATCTGCCTTTATCTCGAGATAAAGGCAGATTCAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-590s1c1
Sequence:CCGGCCACAGACTCAGGAATGATTTCTCGAGAAATCATTCCTGAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-881s1c1
Sequence:CCGGACGCTATGATACTTTCTGGAACTCGAGTTCCAGAAAGTATCATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-782s1c1
Sequence:CCGGGCCAGAAGTTATCTACAAGATCTCGAGATCTTGTAGATAACTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016641.3-882s1c1
Sequence:CCGGCGCTATGATACTTTCTGGAAACTCGAGTTTCCAGAAAGTATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019580
VALIDATED
GDE1 MISSION shRNA Bacterial Glycerol Stock
glycerophosphodiester phosphodiesterase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-461s1c1
Sequence:CCGGCCGACTATGTGATCTGACATTCTCGAGAATGTCAGATCACATAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-384s1c1
Sequence:CCGGGACATCGAGTTTACTTCTGATCTCGAGATCAGAAGTAAACTCGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-975s1c1
Sequence:CCGGGTTGTGAGTTGGACTGTCAATCTCGAGATTGACAGTCCAACTCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-742s1c1
Sequence:CCGGAGAAGGTAATCACAGCCCTAACTCGAGTTAGGGCTGTGATTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-869s1c1
Sequence:CCGGCATGCACAATGTCTTGTGGTACTCGAGTACCACAAGACATTGTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019580
VALIDATED
GDE1 MISSION shRNA shRNA Plasmid DNA
glycerophosphodiester phosphodiesterase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-461s1c1
Sequence:CCGGCCGACTATGTGATCTGACATTCTCGAGAATGTCAGATCACATAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-384s1c1
Sequence:CCGGGACATCGAGTTTACTTCTGATCTCGAGATCAGAAGTAAACTCGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-975s1c1
Sequence:CCGGGTTGTGAGTTGGACTGTCAATCTCGAGATTGACAGTCCAACTCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-742s1c1
Sequence:CCGGAGAAGGTAATCACAGCCCTAACTCGAGTTAGGGCTGTGATTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-869s1c1
Sequence:CCGGCATGCACAATGTCTTGTGGTACTCGAGTACCACAAGACATTGTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019580
VALIDATED
GDE1 MISSION shRNA Lentiviral Transduction Particles
glycerophosphodiester phosphodiesterase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-461s1c1
Sequence:CCGGCCGACTATGTGATCTGACATTCTCGAGAATGTCAGATCACATAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-384s1c1
Sequence:CCGGGACATCGAGTTTACTTCTGATCTCGAGATCAGAAGTAAACTCGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-975s1c1
Sequence:CCGGGTTGTGAGTTGGACTGTCAATCTCGAGATTGACAGTCCAACTCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-742s1c1
Sequence:CCGGAGAAGGTAATCACAGCCCTAACTCGAGTTAGGGCTGTGATTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019580.3-869s1c1
Sequence:CCGGCATGCACAATGTCTTGTGGTACTCGAGTACCACAAGACATTGTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks