EMAIL THIS PAGE TO A FRIEND

GDF10

growth differentiation factor 10

88 Gene Product Result for
Synonyms: BMP-3b BMP3B
UniProtKB ID: P55107, Q5VSQ8, Q9UCX6
Gene ID:
Human(2662) Summary: The protein encoded by this gene is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. Studies in mice suggest that the protein encoded by this gene plays a role in skeletal morphogenesis. [provided by RefSeq, Jul 2008]
Mouse(14560) growth differentiation factor 10
Rat(79216) growth differentiation factor 10
sheep(101115678) growth differentiation factor 10
domestic guinea pig(100722801) growth differentiation factor 10
naked mole-rat(101724231) growth differentiation factor 10
chicken(423776) growth differentiation factor 10
dog(611168) growth differentiation factor 10
cow(539510) growth differentiation factor 10
domestic cat(101087525) growth differentiation factor 10
Horse(100063615) growth differentiation factor 10
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004962 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044381 MISSION® esiRNA esiRNA human GDF10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004962 Rosetta Predictions human pricing
NM_024375 Rosetta Predictions rat pricing
XM_579488 Rosetta Predictions rat pricing
NM_145741 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147462 predicted 2131
2 SASI_Hs01_00147463 predicted 1178
3 SASI_Hs02_00338647 predicted 1951
4 SASI_Hs01_00147464 predicted 2174
5 SASI_Hs01_00147466 predicted 779
6 SASI_Hs01_00147469 predicted 2105
7 SASI_Hs02_00338648 predicted 1775
8 SASI_Hs01_00147470 predicted 1632
9 SASI_Hs02_00338649 predicted 1929
10 SASI_Hs02_00338650 predicted 2011
11 SASI_Hs01_00147465 predicted 1480
12 SASI_Hs01_00147467 predicted 1989
13 SASI_Hs01_00147468 predicted 2123
14 SASI_Hs01_00147471 predicted 2026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119116 predicted 1017
2 SASI_Rn01_00119117 predicted 990
3 SASI_Rn01_00119118 predicted 566
4 SASI_Rn01_00119119 predicted 952
5 SASI_Rn01_00119120 predicted 1384
6 SASI_Rn01_00119121 predicted 1731
7 SASI_Rn01_00119122 predicted 594
8 SASI_Rn02_00263965 predicted 1719
9 SASI_Rn01_00119123 predicted 1407
10 SASI_Rn01_00119124 predicted 1609
11 SASI_Rn01_00119125 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00138960 predicted 646
2 SASI_Rn01_00138961 predicted 683
3 SASI_Rn01_00138962 predicted 538
4 SASI_Rn01_00138963 predicted 476
5 SASI_Rn01_00138964 predicted 476
6 SASI_Rn01_00138965 predicted 655
7 SASI_Rn01_00138966 predicted 647
8 SASI_Rn01_00138967 predicted 539
9 SASI_Rn01_00138968 predicted 437
10 SASI_Rn01_00138969 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038752 predicted 1733
2 SASI_Mm01_00038753 predicted 1060
3 SASI_Mm01_00038754 predicted 1596
4 SASI_Mm01_00038755 predicted 1491
5 SASI_Mm02_00341271 predicted 1270
6 SASI_Mm01_00038756 predicted 630
7 SASI_Mm01_00038757 predicted 1255
8 SASI_Mm01_00038758 predicted 1451
9 SASI_Mm01_00038759 predicted 1084
10 SASI_Mm01_00038760 predicted 902
11 SASI_Mm01_00038761 predicted 1737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004962
GDF10 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004962.2-783s21c1
Sequence:CCGGCGACCAGAAGGCCGTGTATTTCTCGAGAAATACACGGCCTTCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004962.2-2329s21c1
Sequence:CCGGCAGGATAATCGTGGTGTAAATCTCGAGATTTACACCACGATTATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004962.2-2026s21c1
Sequence:CCGGCTGTCCGCCAGTGCATCATTACTCGAGTAATGATGCACTGGCGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-1630s1c1
Sequence:CCGGGAATGGATAATCTCACCGAAACTCGAGTTTCGGTGAGATTATCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-1821s1c1
Sequence:CCGGCCTGGATGAGAATCGGAATGTCTCGAGACATTCCGATTCTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-1789s1c1
Sequence:CCGGCCCGATAAGATGAACTCCCTTCTCGAGAAGGGAGTTCATCTTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-819s1c1
Sequence:CCGGCATGCAAGACTCGGAAATGATCTCGAGATCATTTCCGAGTCTTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-1177s1c1
Sequence:CCGGGCGCCCTACATCCTAGTCTATCTCGAGATAGACTAGGATGTAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004962
GDF10 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004962.2-783s21c1
Sequence:CCGGCGACCAGAAGGCCGTGTATTTCTCGAGAAATACACGGCCTTCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004962.2-2329s21c1
Sequence:CCGGCAGGATAATCGTGGTGTAAATCTCGAGATTTACACCACGATTATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004962.2-2026s21c1
Sequence:CCGGCTGTCCGCCAGTGCATCATTACTCGAGTAATGATGCACTGGCGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-1630s1c1
Sequence:CCGGGAATGGATAATCTCACCGAAACTCGAGTTTCGGTGAGATTATCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-1821s1c1
Sequence:CCGGCCTGGATGAGAATCGGAATGTCTCGAGACATTCCGATTCTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-1789s1c1
Sequence:CCGGCCCGATAAGATGAACTCCCTTCTCGAGAAGGGAGTTCATCTTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-819s1c1
Sequence:CCGGCATGCAAGACTCGGAAATGATCTCGAGATCATTTCCGAGTCTTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-1177s1c1
Sequence:CCGGGCGCCCTACATCCTAGTCTATCTCGAGATAGACTAGGATGTAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004962
GDF10 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004962.2-783s21c1
Sequence:CCGGCGACCAGAAGGCCGTGTATTTCTCGAGAAATACACGGCCTTCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004962.2-2329s21c1
Sequence:CCGGCAGGATAATCGTGGTGTAAATCTCGAGATTTACACCACGATTATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004962.2-2026s21c1
Sequence:CCGGCTGTCCGCCAGTGCATCATTACTCGAGTAATGATGCACTGGCGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-1630s1c1
Sequence:CCGGGAATGGATAATCTCACCGAAACTCGAGTTTCGGTGAGATTATCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-1821s1c1
Sequence:CCGGCCTGGATGAGAATCGGAATGTCTCGAGACATTCCGATTCTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-1789s1c1
Sequence:CCGGCCCGATAAGATGAACTCCCTTCTCGAGAAGGGAGTTCATCTTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-819s1c1
Sequence:CCGGCATGCAAGACTCGGAAATGATCTCGAGATCATTTCCGAGTCTTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004962.2-1177s1c1
Sequence:CCGGGCGCCCTACATCCTAGTCTATCTCGAGATAGACTAGGATGTAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145741
GDF10 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-1636s1c1
Sequence:CCGGCCAGACAAGATGAACTCCCTTCTCGAGAAGGGAGTTCATCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-1083s1c1
Sequence:CCGGGCTACAGAGATACGACCCATTCTCGAGAATGGGTCGTATCTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-1017s1c1
Sequence:CCGGCATGCCCTATATCCTTGTCTACTCGAGTAGACAAGGATATAGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-534s1c1
Sequence:CCGGGCTCAGGCTCTATGAGAAGTACTCGAGTACTTCTCATAGAGCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-633s1c1
Sequence:CCGGGCCTGTGTATTTCTTCAACTTCTCGAGAAGTTGAAGAAATACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145741
GDF10 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-1636s1c1
Sequence:CCGGCCAGACAAGATGAACTCCCTTCTCGAGAAGGGAGTTCATCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-1083s1c1
Sequence:CCGGGCTACAGAGATACGACCCATTCTCGAGAATGGGTCGTATCTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-1017s1c1
Sequence:CCGGCATGCCCTATATCCTTGTCTACTCGAGTAGACAAGGATATAGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-534s1c1
Sequence:CCGGGCTCAGGCTCTATGAGAAGTACTCGAGTACTTCTCATAGAGCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-633s1c1
Sequence:CCGGGCCTGTGTATTTCTTCAACTTCTCGAGAAGTTGAAGAAATACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145741
GDF10 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-1636s1c1
Sequence:CCGGCCAGACAAGATGAACTCCCTTCTCGAGAAGGGAGTTCATCTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-1083s1c1
Sequence:CCGGGCTACAGAGATACGACCCATTCTCGAGAATGGGTCGTATCTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-1017s1c1
Sequence:CCGGCATGCCCTATATCCTTGTCTACTCGAGTAGACAAGGATATAGGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-534s1c1
Sequence:CCGGGCTCAGGCTCTATGAGAAGTACTCGAGTACTTCTCATAGAGCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145741.2-633s1c1
Sequence:CCGGGCCTGTGTATTTCTTCAACTTCTCGAGAAGTTGAAGAAATACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks