EMAIL THIS PAGE TO A FRIEND

GDF11

growth differentiation factor 11

87 Gene Product Result for
Synonyms: BMP-11 BMP11
UniProtKB ID: O95390, Q9UID1, Q9UID2
Gene ID:
Human(10220) Summary: The protein encoded by this gene is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. Studies in mice and Xenopus suggest that this protein is involved in mesodermal formation and neurogenesis during embryonic development. [provided by RefSeq, Jul 2008]
Mouse(14561) growth differentiation factor 11
Rat(29454) growth differentiation factor 11
Zebrafish(406247) growth differentiation factor 11
cow(540517) growth differentiation factor 11
Horse(100058832) growth differentiation factor 11
domestic cat(101090704) growth differentiation factor 11
dog(606826) growth differentiation factor 11
naked mole-rat(101722269) growth differentiation factor 11
domestic guinea pig(100722750) growth differentiation factor 11
sheep(101104900) growth differentiation factor 11
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1480 Human GDF-11 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005811 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_125935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005811 Rosetta Predictions human pricing
XM_001071574 Rosetta Predictions rat pricing
XM_343148 Rosetta Predictions rat pricing
NM_010272 Rosetta Predictions mouse pricing
XM_125935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204331 predicted 619
2 SASI_Hs01_00204332 predicted 799
3 SASI_Hs01_00204333 predicted 727
4 SASI_Hs01_00204334 predicted 745
5 SASI_Hs01_00204335 predicted 608
6 SASI_Hs01_00204336 predicted 694
7 SASI_Hs01_00204338 predicted 884
8 SASI_Hs01_00204339 predicted 1004
9 SASI_Hs01_00204340 predicted 803
10 SASI_Hs02_00340337 predicted 744
11 SASI_Hs01_00204337 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335586 predicted 938
2 SASI_Rn02_00335587 predicted 752
3 SASI_Rn02_00335588 predicted 468
4 SASI_Rn02_00335589 predicted 395
5 SASI_Rn02_00335590 predicted 1022
6 SASI_Rn02_00335591 predicted 706
7 SASI_Rn02_00335592 predicted 852
8 SASI_Rn02_00335593 predicted 493
9 SASI_Rn02_00335594 predicted 839
10 SASI_Rn02_00335595 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395383 predicted 939
2 SASI_Rn02_00395384 predicted 756
3 SASI_Rn02_00395385 predicted 469
4 SASI_Rn02_00395386 predicted 402
5 SASI_Rn02_00395387 predicted 1025
6 SASI_Rn02_00395388 predicted 706
7 SASI_Rn02_00395389 predicted 848
8 SASI_Rn02_00395390 predicted 496
9 SASI_Rn02_00395391 predicted 833
10 SASI_Rn02_00395392 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318188 predicted 1443
2 SASI_Mm02_00318189 predicted 597
3 SASI_Mm02_00318190 predicted 435
4 SASI_Mm02_00318191 predicted 1056
5 SASI_Mm02_00318192 predicted 739
6 SASI_Mm02_00318193 predicted 604
7 SASI_Mm02_00318194 predicted 673
8 SASI_Mm02_00318195 predicted 788
9 SASI_Mm02_00318196 predicted 672
10 SASI_Mm02_00318197 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276790 predicted 568
2 SASI_Mm01_00276791 predicted 402
3 SASI_Mm01_00276792 predicted 1027
4 SASI_Mm01_00276793 predicted 705
5 SASI_Mm01_00276794 predicted 579
6 SASI_Mm01_00276795 predicted 643
7 SASI_Mm01_00276796 predicted 765
8 SASI_Mm01_00276797 predicted 654
9 SASI_Mm01_00276798 predicted 642
10 SASI_Mm01_00276799 predicted 854
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005811
VALIDATED
GDF11 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-1205s1c1
Sequence:CCGGGCAGATTATCTACGGCAAGATCTCGAGATCTTGCCGTAGATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-1172s1c1
Sequence:CCGGCCCAATCAACATGCTCTACTTCTCGAGAAGTAGAGCATGTTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-548s1c1
Sequence:CCGGGATGTTCACAAAGGTACTGAACTCGAGTTCAGTACCTTTGTGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-744s1c1
Sequence:CCGGCAGAGCATCGACTTCAAGCAACTCGAGTTGCTTGAAGTCGATGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-620s1c1
Sequence:CCGGCCTGCAGATCTTGCGACTAAACTCGAGTTTAGTCGCAAGATCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005811.3-1241s21c1
Sequence:CCGGGATCGCTGTGGCTGCTCTTAACTCGAGTTAAGAGCAGCCACAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005811.3-1520s21c1
Sequence:CCGGGAGATGTAGAGACAGTGATAGCTCGAGCTATCACTGTCTCTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005811.3-1027s21c1
Sequence:CCGGCATCGCACCTAAGCGCTACAACTCGAGTTGTAGCGCTTAGGTGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005811
VALIDATED
GDF11 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-1205s1c1
Sequence:CCGGGCAGATTATCTACGGCAAGATCTCGAGATCTTGCCGTAGATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-1172s1c1
Sequence:CCGGCCCAATCAACATGCTCTACTTCTCGAGAAGTAGAGCATGTTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-548s1c1
Sequence:CCGGGATGTTCACAAAGGTACTGAACTCGAGTTCAGTACCTTTGTGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-744s1c1
Sequence:CCGGCAGAGCATCGACTTCAAGCAACTCGAGTTGCTTGAAGTCGATGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-620s1c1
Sequence:CCGGCCTGCAGATCTTGCGACTAAACTCGAGTTTAGTCGCAAGATCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005811.3-1241s21c1
Sequence:CCGGGATCGCTGTGGCTGCTCTTAACTCGAGTTAAGAGCAGCCACAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005811.3-1520s21c1
Sequence:CCGGGAGATGTAGAGACAGTGATAGCTCGAGCTATCACTGTCTCTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005811.3-1027s21c1
Sequence:CCGGCATCGCACCTAAGCGCTACAACTCGAGTTGTAGCGCTTAGGTGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005811
VALIDATED
GDF11 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-1205s1c1
Sequence:CCGGGCAGATTATCTACGGCAAGATCTCGAGATCTTGCCGTAGATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-1172s1c1
Sequence:CCGGCCCAATCAACATGCTCTACTTCTCGAGAAGTAGAGCATGTTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-548s1c1
Sequence:CCGGGATGTTCACAAAGGTACTGAACTCGAGTTCAGTACCTTTGTGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-744s1c1
Sequence:CCGGCAGAGCATCGACTTCAAGCAACTCGAGTTGCTTGAAGTCGATGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005811.2-620s1c1
Sequence:CCGGCCTGCAGATCTTGCGACTAAACTCGAGTTTAGTCGCAAGATCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005811.3-1241s21c1
Sequence:CCGGGATCGCTGTGGCTGCTCTTAACTCGAGTTAAGAGCAGCCACAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005811.3-1520s21c1
Sequence:CCGGGAGATGTAGAGACAGTGATAGCTCGAGCTATCACTGTCTCTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005811.3-1027s21c1
Sequence:CCGGCATCGCACCTAAGCGCTACAACTCGAGTTGTAGCGCTTAGGTGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125935
GDF11 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_125935.4-1439s1c1
Sequence:CCGGGCAAAGGAACAGAGAGGCAAACTCGAGTTTGCCTCTCTGTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125935.4-477s1c1
Sequence:CCGGCCTGCAGATCTTACGACTGAACTCGAGTTCAGTCGTAAGATCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125935.4-553s1c1
Sequence:CCGGCGTATCCGTTCACTAAAGATTCTCGAGAATCTTTAGTGAACGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125935.4-924s1c1
Sequence:CCGGCCAGTGCGAATACATGTTCATCTCGAGATGAACATGTATTCGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125935.4-757s1c1
Sequence:CCGGCGAGTCCTAGAGAACACGAAACTCGAGTTTCGTGTTCTCTAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125935
GDF11 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_125935.4-1439s1c1
Sequence:CCGGGCAAAGGAACAGAGAGGCAAACTCGAGTTTGCCTCTCTGTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125935.4-477s1c1
Sequence:CCGGCCTGCAGATCTTACGACTGAACTCGAGTTCAGTCGTAAGATCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125935.4-553s1c1
Sequence:CCGGCGTATCCGTTCACTAAAGATTCTCGAGAATCTTTAGTGAACGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125935.4-924s1c1
Sequence:CCGGCCAGTGCGAATACATGTTCATCTCGAGATGAACATGTATTCGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125935.4-757s1c1
Sequence:CCGGCGAGTCCTAGAGAACACGAAACTCGAGTTTCGTGTTCTCTAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125935
GDF11 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_125935.4-1439s1c1
Sequence:CCGGGCAAAGGAACAGAGAGGCAAACTCGAGTTTGCCTCTCTGTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125935.4-477s1c1
Sequence:CCGGCCTGCAGATCTTACGACTGAACTCGAGTTCAGTCGTAAGATCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125935.4-553s1c1
Sequence:CCGGCGTATCCGTTCACTAAAGATTCTCGAGAATCTTTAGTGAACGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125935.4-924s1c1
Sequence:CCGGCCAGTGCGAATACATGTTCATCTCGAGATGAACATGTATTCGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125935.4-757s1c1
Sequence:CCGGCGAGTCCTAGAGAACACGAAACTCGAGTTTCGTGTTCTCTAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks