EMAIL THIS PAGE TO A FRIEND

GDF15

growth differentiation factor 15

61 Gene Product Result for
Synonyms: GDF-15 MIC-1 MIC1 NAG-1 PDF PLAB PTGFB
UniProtKB ID: Q99988, O14629, P78360, Q9BWA0, Q9NRT0
Gene ID:
Human(9518) Summary: Bone morphogenetic proteins (e.g., BMP9; MIM 605120) are members of the transforming growth factor-beta (see TGFB1; MIM 190180) superfamily and regulate tissue differentiation and maintenance. They are synthesized as precursor molecules that are processed at a dibasic cleavage site to release C-terminal domains containing a characteristic motif of 7 conserved cysteines in the mature protein.[supplied by OMIM, Oct 2009]
Mouse(23886) growth differentiation factor 15
Rat(29455) growth differentiation factor 15
sheep(100913168) growth differentiation factor 15
domestic guinea pig(100718010) growth differentiation factor 15
naked mole-rat(101722452) growth differentiation factor 15
dog(484822) growth differentiation factor 15
domestic cat(101086633) growth differentiation factor 15
cow(618677) growth differentiation factor 15
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004864 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004864 Rosetta Predictions human pricing
NM_019216 Rosetta Predictions rat pricing
NM_011819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012263 predicted 531
2 SASI_Hs01_00012269 predicted 521
3 SASI_Hs02_00338480 predicted 233
4 SASI_Hs02_00338481 predicted 207
5 SASI_Hs02_00338482 predicted 201
6 SASI_Hs01_00012261 predicted 767
7 SASI_Hs01_00012262 predicted 861
8 SASI_Hs01_00012264 predicted 780
9 SASI_Hs01_00012270 predicted 292
10 SASI_Hs02_00338483 predicted 379
11 SASI_Hs01_00012265 predicted 766
12 SASI_Hs01_00012266 predicted 864
13 SASI_Hs01_00012267 predicted 925
14 SASI_Hs01_00012268 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046954 predicted 537
2 SASI_Rn01_00046955 predicted 591
3 SASI_Rn02_00262059 predicted 245
4 SASI_Rn01_00046956 predicted 538
5 SASI_Rn01_00046957 predicted 324
6 SASI_Rn01_00046958 predicted 587
7 SASI_Rn01_00046959 predicted 271
8 SASI_Rn01_00046961 predicted 335
9 SASI_Rn01_00046962 predicted 354
10 SASI_Rn01_00046963 predicted 580
11 SASI_Rn01_00046960 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107429 predicted 641
2 SASI_Mm01_00107433 predicted 734
3 SASI_Mm01_00107436 predicted 329
4 SASI_Mm01_00107437 predicted 596
5 SASI_Mm01_00107438 predicted 342
6 SASI_Mm02_00321520 predicted 493
7 SASI_Mm02_00321521 predicted 642
8 SASI_Mm02_00321522 predicted 582
9 SASI_Mm02_00321523 predicted 333
10 SASI_Mm02_00321524 predicted 670
11 SASI_Mm01_00107430 predicted 780
12 SASI_Mm01_00107431 predicted 998
13 SASI_Mm01_00107432 predicted 1058
14 SASI_Mm01_00107434 predicted 1103
15 SASI_Mm01_00107435 predicted 1147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004864
VALIDATED
GDF15 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004864.2-244s21c1
Sequence:CCGGAGAGCTGGGAAGATTCGAACACTCGAGTGTTCGAATCTTCCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004864.2-66s21c1
Sequence:CCGGTCTCAGATGCTCCTGGTGTTGCTCGAGCAACACCAGGAGCATCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004864.2-194s21c1
Sequence:CCGGAGAGTTGCGGAAACGCTACGACTCGAGTCGTAGCGTTTCCGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004864.2-206s21c1
Sequence:CCGGACGCTACGAGGACCTGCTAACCTCGAGGTTAGCAGGTCCTCGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004864.1-283s1c1
Sequence:CCGGCCGGATACTCACGCCAGAAGTCTCGAGACTTCTGGCGTGAGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004864.1-904s1c1
Sequence:CCGGGCTCCAGACCTATGATGACTTCTCGAGAAGTCATCATAGGTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004864.1-913s1c1
Sequence:CCGGCTATGATGACTTGTTAGCCAACTCGAGTTGGCTAACAAGTCATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004864.1-152s1c1
Sequence:CCGGCCCTCAGAGTTGCACTCCGAACTCGAGTTCGGAGTGCAACTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004864.1-172s1c1
Sequence:CCGGAGACTCCAGATTCCGAGAGTTCTCGAGAACTCTCGGAATCTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004864
VALIDATED
GDF15 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004864.2-244s21c1
Sequence:CCGGAGAGCTGGGAAGATTCGAACACTCGAGTGTTCGAATCTTCCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004864.2-66s21c1
Sequence:CCGGTCTCAGATGCTCCTGGTGTTGCTCGAGCAACACCAGGAGCATCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004864.2-194s21c1
Sequence:CCGGAGAGTTGCGGAAACGCTACGACTCGAGTCGTAGCGTTTCCGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004864.2-206s21c1
Sequence:CCGGACGCTACGAGGACCTGCTAACCTCGAGGTTAGCAGGTCCTCGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004864.1-283s1c1
Sequence:CCGGCCGGATACTCACGCCAGAAGTCTCGAGACTTCTGGCGTGAGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004864.1-904s1c1
Sequence:CCGGGCTCCAGACCTATGATGACTTCTCGAGAAGTCATCATAGGTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004864.1-913s1c1
Sequence:CCGGCTATGATGACTTGTTAGCCAACTCGAGTTGGCTAACAAGTCATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004864.1-152s1c1
Sequence:CCGGCCCTCAGAGTTGCACTCCGAACTCGAGTTCGGAGTGCAACTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004864.1-172s1c1
Sequence:CCGGAGACTCCAGATTCCGAGAGTTCTCGAGAACTCTCGGAATCTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004864
VALIDATED
GDF15 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004864.2-244s21c1
Sequence:CCGGAGAGCTGGGAAGATTCGAACACTCGAGTGTTCGAATCTTCCCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004864.2-66s21c1
Sequence:CCGGTCTCAGATGCTCCTGGTGTTGCTCGAGCAACACCAGGAGCATCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004864.2-194s21c1
Sequence:CCGGAGAGTTGCGGAAACGCTACGACTCGAGTCGTAGCGTTTCCGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004864.2-206s21c1
Sequence:CCGGACGCTACGAGGACCTGCTAACCTCGAGGTTAGCAGGTCCTCGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004864.1-283s1c1
Sequence:CCGGCCGGATACTCACGCCAGAAGTCTCGAGACTTCTGGCGTGAGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004864.1-904s1c1
Sequence:CCGGGCTCCAGACCTATGATGACTTCTCGAGAAGTCATCATAGGTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004864.1-913s1c1
Sequence:CCGGCTATGATGACTTGTTAGCCAACTCGAGTTGGCTAACAAGTCATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004864.1-152s1c1
Sequence:CCGGCCCTCAGAGTTGCACTCCGAACTCGAGTTCGGAGTGCAACTCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004864.1-172s1c1
Sequence:CCGGAGACTCCAGATTCCGAGAGTTCTCGAGAACTCTCGGAATCTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011819
VALIDATED
GDF15 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011819.1-603s1c1
Sequence:CCGGGCCCTGGCAATGCCTGAACAACTCGAGTTGTTCAGGCATTGCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011819.1-1353s1c1
Sequence:CCGGGTGTCACTGCAGACTTATGATCTCGAGATCATAAGTCTGCAGTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011819.1-714s1c1
Sequence:CCGGCGAGAGGACTCGAACTCAGAACTCGAGTTCTGAGTTCGAGTCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011819.1-536s1c1
Sequence:CCGGTCAACTGAGGTTCCTGCTGTTCTCGAGAACAGCAGGAACCTCAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011819.1-1127s1c1
Sequence:CCGGGCAGGCAACTCTTGAAGACTTCTCGAGAAGTCTTCAAGAGTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011819
VALIDATED
GDF15 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011819.1-603s1c1
Sequence:CCGGGCCCTGGCAATGCCTGAACAACTCGAGTTGTTCAGGCATTGCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011819.1-1353s1c1
Sequence:CCGGGTGTCACTGCAGACTTATGATCTCGAGATCATAAGTCTGCAGTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011819.1-714s1c1
Sequence:CCGGCGAGAGGACTCGAACTCAGAACTCGAGTTCTGAGTTCGAGTCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011819.1-536s1c1
Sequence:CCGGTCAACTGAGGTTCCTGCTGTTCTCGAGAACAGCAGGAACCTCAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011819.1-1127s1c1
Sequence:CCGGGCAGGCAACTCTTGAAGACTTCTCGAGAAGTCTTCAAGAGTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011819
VALIDATED
GDF15 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011819.1-603s1c1
Sequence:CCGGGCCCTGGCAATGCCTGAACAACTCGAGTTGTTCAGGCATTGCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011819.1-1353s1c1
Sequence:CCGGGTGTCACTGCAGACTTATGATCTCGAGATCATAAGTCTGCAGTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011819.1-714s1c1
Sequence:CCGGCGAGAGGACTCGAACTCAGAACTCGAGTTCTGAGTTCGAGTCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011819.1-536s1c1
Sequence:CCGGTCAACTGAGGTTCCTGCTGTTCTCGAGAACAGCAGGAACCTCAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011819.1-1127s1c1
Sequence:CCGGGCAGGCAACTCTTGAAGACTTCTCGAGAAGTCTTCAAGAGTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks