EMAIL THIS PAGE TO A FRIEND

GDF1

growth differentiation factor 1

44 Gene Product Result for
Synonyms: DORV DTGA3
UniProtKB ID: P27539, O43344
Gene ID:
Human(2657) Summary: This gene encodes a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site that is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. Studies in rodents suggest that this protein is involved in the establishment of left-right asymmetry in early embryogenesis and in neural development in later embryogenesis. This protein is transcribed from a bicistronic mRNA that also encodes the longevity assurance gene. [provided by RefSeq, Jul 2008]
Mouse(14559) growth differentiation factor 1
Rat(306351) growth differentiation factor 1
dog(100686938) growth differentiation factor 1
domestic cat(101096297) growth differentiation factor 1
cow(508576) growth differentiation factor 1
naked mole-rat(101705795) growth differentiation factor 1
domestic guinea pig(100714093) growth differentiation factor 1
sheep(101107353) growth differentiation factor 1
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001492 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008107 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008107 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008107 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU061971 MISSION® esiRNA esiRNA targeting mouse Gdf1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001492 Rosetta Predictions human pricing
NM_001044240 Rosetta Predictions rat pricing
NM_008107 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224805 predicted 1753
2 SASI_Hs01_00224806 predicted 2416
3 SASI_Hs01_00224807 predicted 1679
4 SASI_Hs01_00224808 predicted 1507
5 SASI_Hs01_00224809 predicted 2473
6 SASI_Hs01_00224810 predicted 2419
7 SASI_Hs01_00224811 predicted 1512
8 SASI_Hs01_00224812 predicted 1568
9 SASI_Hs01_00224813 predicted 1571
10 SASI_Hs01_00224814 predicted 2338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205127 predicted 890
2 SASI_Rn02_00205128 predicted 991
3 SASI_Rn02_00205129 predicted 763
4 SASI_Rn02_00205130 predicted 1081
5 SASI_Rn02_00205131 predicted 709
6 SASI_Rn02_00205132 predicted 778
7 SASI_Rn02_00205133 predicted 1005
8 SASI_Rn02_00205134 predicted 1503
9 SASI_Rn02_00205135 predicted 858
10 SASI_Rn02_00205136 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313153 predicted 928
2 SASI_Mm01_00078314 predicted 730
3 SASI_Mm01_00078315 predicted 859
4 SASI_Mm01_00078316 predicted 1185
5 SASI_Mm01_00078317 predicted 634
6 SASI_Mm01_00078318 predicted 822
7 SASI_Mm01_00078319 predicted 628
8 SASI_Mm01_00078320 predicted 1215
9 SASI_Mm01_00078321 predicted 1367
10 SASI_Mm01_00078323 predicted 728
11 SASI_Mm01_00078322 predicted 1038
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001492
GDF1 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000058338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001492.3-1766s1c1
Sequence:CCGGCCCTGAGTGGACAGTCGTCTTCTCGAGAAGACGACTGTCCACTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001492.3-2268s1c1
Sequence:CCGGCTGGCCAACTACTGCCAGGGTCTCGAGACCCTGGCAGTAGTTGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001492.3-1688s1c1
Sequence:CCGGCGGAAACATCGTGCGCCACATCTCGAGATGTGGCGCACGATGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001492
GDF1 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000058338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001492.3-1766s1c1
Sequence:CCGGCCCTGAGTGGACAGTCGTCTTCTCGAGAAGACGACTGTCCACTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001492.3-2268s1c1
Sequence:CCGGCTGGCCAACTACTGCCAGGGTCTCGAGACCCTGGCAGTAGTTGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001492.3-1688s1c1
Sequence:CCGGCGGAAACATCGTGCGCCACATCTCGAGATGTGGCGCACGATGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001492
GDF1 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000058338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001492.3-1766s1c1
Sequence:CCGGCCCTGAGTGGACAGTCGTCTTCTCGAGAAGACGACTGTCCACTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001492.3-2268s1c1
Sequence:CCGGCTGGCCAACTACTGCCAGGGTCTCGAGACCCTGGCAGTAGTTGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001492.3-1688s1c1
Sequence:CCGGCGGAAACATCGTGCGCCACATCTCGAGATGTGGCGCACGATGTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008107
GDF1 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-823s1c1
Sequence:CCGGGTCGTCTTTGACCTGTCGAATCTCGAGATTCGACAGGTCAAAGACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-1459s1c1
Sequence:CCGGTCCGTGCTCTTCTTCGACAATCTCGAGATTGTCGAAGAAGAGCACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-703s1c1
Sequence:CCGGCCATGCCACGTGGAGGAACTACTCGAGTAGTTCCTCCACGTGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-1494s1c1
Sequence:CCGGCCTGCGACACTACGAAGACATCTCGAGATGTCTTCGTAGTGTCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-1284s1c2
Sequence:CCGGGCGTGGCTTCCTAGCCAACTTCTCGAGAAGTTGGCTAGGAAGCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008107
GDF1 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-823s1c1
Sequence:CCGGGTCGTCTTTGACCTGTCGAATCTCGAGATTCGACAGGTCAAAGACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-1459s1c1
Sequence:CCGGTCCGTGCTCTTCTTCGACAATCTCGAGATTGTCGAAGAAGAGCACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-703s1c1
Sequence:CCGGCCATGCCACGTGGAGGAACTACTCGAGTAGTTCCTCCACGTGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-1494s1c1
Sequence:CCGGCCTGCGACACTACGAAGACATCTCGAGATGTCTTCGTAGTGTCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-1284s1c2
Sequence:CCGGGCGTGGCTTCCTAGCCAACTTCTCGAGAAGTTGGCTAGGAAGCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008107
GDF1 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-823s1c1
Sequence:CCGGGTCGTCTTTGACCTGTCGAATCTCGAGATTCGACAGGTCAAAGACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-1459s1c1
Sequence:CCGGTCCGTGCTCTTCTTCGACAATCTCGAGATTGTCGAAGAAGAGCACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-703s1c1
Sequence:CCGGCCATGCCACGTGGAGGAACTACTCGAGTAGTTCCTCCACGTGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-1494s1c1
Sequence:CCGGCCTGCGACACTACGAAGACATCTCGAGATGTCTTCGTAGTGTCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008107.2-1284s1c2
Sequence:CCGGGCGTGGCTTCCTAGCCAACTTCTCGAGAAGTTGGCTAGGAAGCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)