EMAIL THIS PAGE TO A FRIEND

GDF2

growth differentiation factor 2

52 Gene Product Result for
Synonyms: BMP-9 BMP9
UniProtKB ID: Q9UK05, Q5VSQ9, Q9Y571
Gene ID:
Human(2658) Summary: The protein encoded by this gene is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. Studies in rodents suggest that this protein plays a role in the adult liver and in differentiation of cholinergic central nervous system neurons. [provided by RefSeq, Jul 2008]
Mouse(12165) growth differentiation factor 2
Rat(290921) growth differentiation factor 2
Zebrafish(563287) growth differentiation factor 2
chicken(396412) growth differentiation factor 2
cow(540384) growth differentiation factor 2
domestic cat(101087270) growth differentiation factor 2
Horse(100051984) growth differentiation factor 2
dog(611149) growth differentiation factor 2
naked mole-rat(101727869) growth differentiation factor 2
domestic guinea pig(100723076) growth differentiation factor 2
sheep(101115426) growth differentiation factor 2
Domestic Rabbit(100351972) growth differentiation factor 2
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016204 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150141 MISSION® esiRNA esiRNA human GDF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016204 Rosetta Predictions human pricing
NM_001106096 Rosetta Predictions rat pricing
NM_019506 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101967 predicted 552
2 SASI_Hs01_00101969 predicted 668
3 SASI_Hs01_00101970 predicted 1207
4 SASI_Hs01_00101971 predicted 1639
5 SASI_Hs01_00101972 predicted 656
6 SASI_Hs01_00101973 predicted 1088
7 SASI_Hs01_00101974 predicted 1211
8 SASI_Hs01_00101975 predicted 1595
9 SASI_Hs01_00101976 predicted 1595
10 SASI_Hs02_00349050 predicted 709
11 SASI_Hs01_00101968 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215592 predicted 678
2 SASI_Rn02_00215593 predicted 310
3 SASI_Rn02_00215594 predicted 1498
4 SASI_Rn02_00215595 predicted 1310
5 SASI_Rn02_00215596 predicted 610
6 SASI_Rn02_00215597 predicted 1310
7 SASI_Rn02_00215598 predicted 623
8 SASI_Rn02_00215599 predicted 561
9 SASI_Rn02_00215600 predicted 1167
10 SASI_Rn02_00215601 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043671 predicted 1467
2 SASI_Mm02_00324544 predicted 560
3 SASI_Mm01_00043672 predicted 1150
4 SASI_Mm01_00043673 predicted 971
5 SASI_Mm01_00043674 predicted 598
6 SASI_Mm01_00043675 predicted 1216
7 SASI_Mm01_00043676 predicted 372
8 SASI_Mm01_00043677 predicted 672
9 SASI_Mm01_00043678 predicted 711
10 SASI_Mm01_00043679 predicted 1427
11 SASI_Mm01_00043680 predicted 1095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016204
GDF2 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-421s1c1
Sequence:CCGGGCAGTACATGATTGACCTGTACTCGAGTACAGGTCAATCATGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-442s1c1
Sequence:CCGGCAACAGGTACACGTCCGATAACTCGAGTTATCGGACGTGTACCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-553s1c1
Sequence:CCGGGCACATCTTGCTCTTCAACATCTCGAGATGTTGAAGAGCAAGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-1369s1c1
Sequence:CCGGCGTCCTCTACAAGGATGACATCTCGAGATGTCATCCTTGTAGAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-1159s1c1
Sequence:CCGGGCGGGTAAACTTCGAGGACATCTCGAGATGTCCTCGAAGTTTACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016204.1-1523s21c1
Sequence:CCGGACAACAAGGACTGATTCAATCCTCGAGGATTGAATCAGTCCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016204.1-660s21c1
Sequence:CCGGTGAAAGGAAGCGTGGTCATTTCTCGAGAAATGACCACGCTTCCTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016204.1-1214s21c1
Sequence:CCGGTATGAAGCCTACGAGTGTAAGCTCGAGCTTACACTCGTAGGCTTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016204
GDF2 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-421s1c1
Sequence:CCGGGCAGTACATGATTGACCTGTACTCGAGTACAGGTCAATCATGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-442s1c1
Sequence:CCGGCAACAGGTACACGTCCGATAACTCGAGTTATCGGACGTGTACCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-553s1c1
Sequence:CCGGGCACATCTTGCTCTTCAACATCTCGAGATGTTGAAGAGCAAGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-1369s1c1
Sequence:CCGGCGTCCTCTACAAGGATGACATCTCGAGATGTCATCCTTGTAGAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-1159s1c1
Sequence:CCGGGCGGGTAAACTTCGAGGACATCTCGAGATGTCCTCGAAGTTTACCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016204.1-1523s21c1
Sequence:CCGGACAACAAGGACTGATTCAATCCTCGAGGATTGAATCAGTCCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016204.1-660s21c1
Sequence:CCGGTGAAAGGAAGCGTGGTCATTTCTCGAGAAATGACCACGCTTCCTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016204.1-1214s21c1
Sequence:CCGGTATGAAGCCTACGAGTGTAAGCTCGAGCTTACACTCGTAGGCTTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016204
GDF2 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-421s1c1
Sequence:CCGGGCAGTACATGATTGACCTGTACTCGAGTACAGGTCAATCATGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-442s1c1
Sequence:CCGGCAACAGGTACACGTCCGATAACTCGAGTTATCGGACGTGTACCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-553s1c1
Sequence:CCGGGCACATCTTGCTCTTCAACATCTCGAGATGTTGAAGAGCAAGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-1369s1c1
Sequence:CCGGCGTCCTCTACAAGGATGACATCTCGAGATGTCATCCTTGTAGAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016204.1-1159s1c1
Sequence:CCGGGCGGGTAAACTTCGAGGACATCTCGAGATGTCCTCGAAGTTTACCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016204.1-1523s21c1
Sequence:CCGGACAACAAGGACTGATTCAATCCTCGAGGATTGAATCAGTCCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016204.1-660s21c1
Sequence:CCGGTGAAAGGAAGCGTGGTCATTTCTCGAGAAATGACCACGCTTCCTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016204.1-1214s21c1
Sequence:CCGGTATGAAGCCTACGAGTGTAAGCTCGAGCTTACACTCGTAGGCTTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019506
GDF2 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019506.2-1977s1c1
Sequence:CCGGCGTGTATTGATGGAGTCACTACTCGAGTAGTGACTCCATCAATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019506.2-1151s1c1
Sequence:CCGGCCCAAGGAATATGACGCCTATCTCGAGATAGGCGTCATATTCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019506.2-505s1c1
Sequence:CCGGCCTGATCTTCAACATCTCCATCTCGAGATGGAGATGTTGAAGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019506.2-711s1c1
Sequence:CCGGGATGGGAGACTTTAGAAGTATCTCGAGATACTTCTAAAGTCTCCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019506.2-367s1c1
Sequence:CCGGCCAGTACATGATCGACTTGTACTCGAGTACAAGTCGATCATGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019506.4-1608s21c1
Sequence:CCGGGAAGGGTTAGTGGGTAGAAAGCTCGAGCTTTCTACCCACTAACCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019506
GDF2 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019506.2-1977s1c1
Sequence:CCGGCGTGTATTGATGGAGTCACTACTCGAGTAGTGACTCCATCAATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019506.2-1151s1c1
Sequence:CCGGCCCAAGGAATATGACGCCTATCTCGAGATAGGCGTCATATTCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019506.2-505s1c1
Sequence:CCGGCCTGATCTTCAACATCTCCATCTCGAGATGGAGATGTTGAAGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019506.2-711s1c1
Sequence:CCGGGATGGGAGACTTTAGAAGTATCTCGAGATACTTCTAAAGTCTCCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019506.2-367s1c1
Sequence:CCGGCCAGTACATGATCGACTTGTACTCGAGTACAAGTCGATCATGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019506.4-1608s21c1
Sequence:CCGGGAAGGGTTAGTGGGTAGAAAGCTCGAGCTTTCTACCCACTAACCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019506
GDF2 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019506.2-1977s1c1
Sequence:CCGGCGTGTATTGATGGAGTCACTACTCGAGTAGTGACTCCATCAATACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019506.2-1151s1c1
Sequence:CCGGCCCAAGGAATATGACGCCTATCTCGAGATAGGCGTCATATTCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019506.2-505s1c1
Sequence:CCGGCCTGATCTTCAACATCTCCATCTCGAGATGGAGATGTTGAAGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019506.2-711s1c1
Sequence:CCGGGATGGGAGACTTTAGAAGTATCTCGAGATACTTCTAAAGTCTCCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019506.2-367s1c1
Sequence:CCGGCCAGTACATGATCGACTTGTACTCGAGTACAAGTCGATCATGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019506.4-1608s21c1
Sequence:CCGGGAAGGGTTAGTGGGTAGAAAGCTCGAGCTTTCTACCCACTAACCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)