EMAIL THIS PAGE TO A FRIEND

GDF3

growth differentiation factor 3

54 Gene Product Result for
Synonyms: KFS3 MCOP7 MCOPCB6
UniProtKB ID: Q9NR23, Q8NEJ4
Gene ID:
Human(9573) Summary: The protein encoded by this gene is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. [provided by RefSeq, Jul 2008]
Mouse(14562) growth differentiation factor 3
Rat(500311) growth differentiation factor 3
sheep(101103967) growth differentiation factor 3
domestic guinea pig(100733509) growth differentiation factor 3
naked mole-rat(101728460) growth differentiation factor 3
chicken(396132) growth differentiation factor 3
cow(786521) growth differentiation factor 3
domestic cat(101097251) growth differentiation factor 3
dog(477702) growth differentiation factor 3
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1481 Human GDF-3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020634 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008108 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008108 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008108 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005391 MISSION® esiRNA esiRNA targeting human GDF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020634 Rosetta Predictions human pricing
NM_001109671 Rosetta Predictions rat pricing
NM_008108 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058631 predicted 230
2 SASI_Hs01_00058632 predicted 234
3 SASI_Hs01_00058635 predicted 925
4 SASI_Hs01_00058636 predicted 300
5 SASI_Hs01_00058639 predicted 752
6 SASI_Hs01_00058640 predicted 953
7 SASI_Hs02_00353612 predicted 537
8 SASI_Hs02_00353613 predicted 631
9 SASI_Hs01_00058633 predicted 695
10 SASI_Hs01_00058634 predicted 959
11 SASI_Hs01_00058637 predicted 347
12 SASI_Hs01_00058638 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250572 predicted 718
2 SASI_Rn02_00250573 predicted 700
3 SASI_Rn02_00250574 predicted 692
4 SASI_Rn02_00250575 predicted 353
5 SASI_Rn02_00250576 predicted 311
6 SASI_Rn02_00250577 predicted 733
7 SASI_Rn02_00250578 predicted 1021
8 SASI_Rn02_00250579 predicted 987
9 SASI_Rn02_00250580 predicted 874
10 SASI_Rn02_00250581 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008108 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313154 predicted 681
2 SASI_Mm02_00313155 predicted 704
3 SASI_Mm02_00313156 predicted 801
4 SASI_Mm02_00313157 predicted 1124
5 SASI_Mm02_00313158 predicted 583
6 SASI_Mm02_00313159 predicted 689
7 SASI_Mm02_00313160 predicted 733
8 SASI_Mm02_00313161 predicted 731
9 SASI_Mm02_00313162 predicted 1259
10 SASI_Mm02_00313163 predicted 1267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020634
GDF3 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020634.1-88s21c1
Sequence:CCGGTTGGGCCAGGCAGTCCAATTTCTCGAGAAATTGGACTGCCTGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020634.1-830s21c1
Sequence:CCGGACCGTCACCAGCTATTCATTACTCGAGTAATGAATAGCTGGTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020634.1-947s21c1
Sequence:CCGGCTCTCAACAGCTCCAATTATGCTCGAGCATAATTGGAGCTGTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-236s1c1
Sequence:CCGGCCCGAGACTTATGCTACGTAACTCGAGTTACGTAGCATAAGTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-124s1c1
Sequence:CCGGCTCCAATTTCTGGGCTTAGATCTCGAGATCTAAGCCCAGAAATTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-1073s1c1
Sequence:CCGGACAATGTCATTCTACGACATTCTCGAGAATGTCGTAGAATGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-175s1c1
Sequence:CCGGGTGCCTTATATCTTGAAGAAACTCGAGTTTCTTCAAGATATAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-432s1c1
Sequence:CCGGGCCCAATTCTTACTATAACCTCTCGAGAGGTTATAGTAAGAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020634
GDF3 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020634.1-88s21c1
Sequence:CCGGTTGGGCCAGGCAGTCCAATTTCTCGAGAAATTGGACTGCCTGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020634.1-830s21c1
Sequence:CCGGACCGTCACCAGCTATTCATTACTCGAGTAATGAATAGCTGGTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020634.1-947s21c1
Sequence:CCGGCTCTCAACAGCTCCAATTATGCTCGAGCATAATTGGAGCTGTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-236s1c1
Sequence:CCGGCCCGAGACTTATGCTACGTAACTCGAGTTACGTAGCATAAGTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-124s1c1
Sequence:CCGGCTCCAATTTCTGGGCTTAGATCTCGAGATCTAAGCCCAGAAATTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-1073s1c1
Sequence:CCGGACAATGTCATTCTACGACATTCTCGAGAATGTCGTAGAATGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-175s1c1
Sequence:CCGGGTGCCTTATATCTTGAAGAAACTCGAGTTTCTTCAAGATATAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-432s1c1
Sequence:CCGGGCCCAATTCTTACTATAACCTCTCGAGAGGTTATAGTAAGAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020634
GDF3 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020634.1-88s21c1
Sequence:CCGGTTGGGCCAGGCAGTCCAATTTCTCGAGAAATTGGACTGCCTGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020634.1-830s21c1
Sequence:CCGGACCGTCACCAGCTATTCATTACTCGAGTAATGAATAGCTGGTGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020634.1-947s21c1
Sequence:CCGGCTCTCAACAGCTCCAATTATGCTCGAGCATAATTGGAGCTGTTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-236s1c1
Sequence:CCGGCCCGAGACTTATGCTACGTAACTCGAGTTACGTAGCATAAGTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-124s1c1
Sequence:CCGGCTCCAATTTCTGGGCTTAGATCTCGAGATCTAAGCCCAGAAATTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-1073s1c1
Sequence:CCGGACAATGTCATTCTACGACATTCTCGAGAATGTCGTAGAATGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-175s1c1
Sequence:CCGGGTGCCTTATATCTTGAAGAAACTCGAGTTTCTTCAAGATATAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020634.1-432s1c1
Sequence:CCGGGCCCAATTCTTACTATAACCTCTCGAGAGGTTATAGTAAGAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008108
GDF3 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-1019s1c1
Sequence:CCGGCCCTTCTCAATGACCACGTATCTCGAGATACGTGGTCATTGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-703s1c1
Sequence:CCGGCCGACTGAAGAATTTGGACTTCTCGAGAAGTCCAAATTCTTCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-682s1c1
Sequence:CCGGGCTTAAGGATTGGAGCAGCAACTCGAGTTGCTGCTCCAATCCTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-191s1c1
Sequence:CCGGGAGTTTCAAGACTCTGACCTTCTCGAGAAGGTCAGAGTCTTGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-325s1c1
Sequence:CCGGGCAGGACTTATGCTACGTGAACTCGAGTTCACGTAGCATAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008108
GDF3 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-1019s1c1
Sequence:CCGGCCCTTCTCAATGACCACGTATCTCGAGATACGTGGTCATTGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-703s1c1
Sequence:CCGGCCGACTGAAGAATTTGGACTTCTCGAGAAGTCCAAATTCTTCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-682s1c1
Sequence:CCGGGCTTAAGGATTGGAGCAGCAACTCGAGTTGCTGCTCCAATCCTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-191s1c1
Sequence:CCGGGAGTTTCAAGACTCTGACCTTCTCGAGAAGGTCAGAGTCTTGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-325s1c1
Sequence:CCGGGCAGGACTTATGCTACGTGAACTCGAGTTCACGTAGCATAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008108
GDF3 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-1019s1c1
Sequence:CCGGCCCTTCTCAATGACCACGTATCTCGAGATACGTGGTCATTGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-703s1c1
Sequence:CCGGCCGACTGAAGAATTTGGACTTCTCGAGAAGTCCAAATTCTTCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-682s1c1
Sequence:CCGGGCTTAAGGATTGGAGCAGCAACTCGAGTTGCTGCTCCAATCCTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-191s1c1
Sequence:CCGGGAGTTTCAAGACTCTGACCTTCTCGAGAAGGTCAGAGTCTTGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008108.1-325s1c1
Sequence:CCGGGCAGGACTTATGCTACGTGAACTCGAGTTCACGTAGCATAAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks