EMAIL THIS PAGE TO A FRIEND

GDF6

growth differentiation factor 6

120 Gene Product Result for
Synonyms: BMP13 CDMP2 KFM KFS KFS1 KFSL LCA17 MCOP4 MCOPCB6 SCDO4 SGM1
UniProtKB ID: Q6KF10, Q6PI58
Gene ID:
Human(392255) Summary: This gene encodes a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily of secreted signaling molecules. It is required for normal formation of some bones and joints in the limbs, skull, and axial skeleton. Mutations in this gene result in colobomata, which are congenital abnormalities in ocular development, and in Klippel-Feil syndrome (KFS), which is a congenital disorder of spinal segmentation. [provided by RefSeq, Jul 2008]
Mouse(242316) growth differentiation factor 6
Rat(252834) growth differentiation factor 6
cow(407175) growth differentiation factor 6
dog(100686579) growth differentiation factor 6
Horse(100059475) growth differentiation factor 6
sheep(101108925) growth differentiation factor 6
domestic guinea pig(100731904) growth differentiation factor 6
naked mole-rat(101706999) growth differentiation factor 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1482 Human GDF-8 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001557 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001557 Rosetta Predictions human pricing
NM_001013038 Rosetta Predictions rat pricing
NM_013526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180587 predicted 466
2 SASI_Hs01_00180588 predicted 389
3 SASI_Hs02_00303823 predicted 546
4 SASI_Hs01_00180589 predicted 1371
5 SASI_Hs01_00180590 predicted 417
6 SASI_Hs01_00180591 predicted 1394
7 SASI_Hs02_00303824 predicted 550
8 SASI_Hs01_00180592 predicted 449
9 SASI_Hs01_00180593 predicted 221
10 SASI_Hs01_00180594 predicted 401
11 SASI_Hs01_00180595 predicted 1474
12 SASI_Hs01_00180596 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200631 predicted 1349
2 SASI_Rn01_00122287 predicted 480
3 SASI_Rn01_00122288 predicted 537
4 SASI_Rn01_00122289 predicted 401
5 SASI_Rn01_00122290 predicted 974
6 SASI_Rn01_00122292 predicted 478
7 SASI_Rn01_00122293 predicted 518
8 SASI_Rn01_00122294 predicted 784
9 SASI_Rn01_00122295 predicted 414
10 SASI_Rn01_00122296 predicted 1185
11 SASI_Rn01_00122291 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068093 predicted 259
2 SASI_Mm02_00322221 predicted 1168
3 SASI_Mm01_00068095 predicted 969
4 SASI_Mm01_00068096 predicted 491
5 SASI_Mm01_00068097 predicted 1397
6 SASI_Mm01_00068098 predicted 673
7 SASI_Mm01_00068099 predicted 479
8 SASI_Mm01_00068100 predicted 522
9 SASI_Mm01_00068101 predicted 1393
10 SASI_Mm01_00068102 predicted 884
11 SASI_Mm01_00068094 predicted 575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013526
GDF6 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013526.1-545s1c1
Sequence:CCGGCGGAGACAGAAGTATTTGTTTCTCGAGAAACAAATACTTCTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013526.1-485s1c1
Sequence:CCGGGCTAATACGATCACTAGCTTTCTCGAGAAAGCTAGTGATCGTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013526.1-480s1c1
Sequence:CCGGAGTCAGCTAATACGATCACTACTCGAGTAGTGATCGTATTAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013526.1-3103s1c1
Sequence:CCGGGCCAGGAGAAATAACTTAAATCTCGAGATTTAAGTTATTTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013526.1-409s1c1
Sequence:CCGGGCTGTCAATCTACAAGACTTACTCGAGTAAGTCTTGTAGATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013526
GDF6 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013526.1-545s1c1
Sequence:CCGGCGGAGACAGAAGTATTTGTTTCTCGAGAAACAAATACTTCTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013526.1-485s1c1
Sequence:CCGGGCTAATACGATCACTAGCTTTCTCGAGAAAGCTAGTGATCGTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013526.1-480s1c1
Sequence:CCGGAGTCAGCTAATACGATCACTACTCGAGTAGTGATCGTATTAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013526.1-3103s1c1
Sequence:CCGGGCCAGGAGAAATAACTTAAATCTCGAGATTTAAGTTATTTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013526.1-409s1c1
Sequence:CCGGGCTGTCAATCTACAAGACTTACTCGAGTAAGTCTTGTAGATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013526
GDF6 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013526.1-545s1c1
Sequence:CCGGCGGAGACAGAAGTATTTGTTTCTCGAGAAACAAATACTTCTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013526.1-485s1c1
Sequence:CCGGGCTAATACGATCACTAGCTTTCTCGAGAAAGCTAGTGATCGTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013526.1-480s1c1
Sequence:CCGGAGTCAGCTAATACGATCACTACTCGAGTAGTGATCGTATTAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013526.1-3103s1c1
Sequence:CCGGGCCAGGAGAAATAACTTAAATCTCGAGATTTAAGTTATTTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013526.1-409s1c1
Sequence:CCGGGCTGTCAATCTACAAGACTTACTCGAGTAAGTCTTGTAGATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001557
GDF6 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 6
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-1375s1c1
Sequence:CCGGGACTCCCATCAGCATTCTATACTCGAGTATAGAATGCTGATGGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001557.1-394s1c1
Sequence:CCGGGCTGTCAATCTACAGGACTTACTCGAGTAAGTCCTGTAGATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-1369s1c1
Sequence:CCGGCAAATTGACTCCCATCAGCATCTCGAGATGCTGATGGGAGTCAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-455s1c1
Sequence:CCGGCAGTCTTCCAAGTCGGCTAATCTCGAGATTAGCCGACTTGGAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-958s1c1
Sequence:CCGGCAAGAACCTGTTCGCAGAGATCTCGAGATCTCTGCGAACAGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001557.1-554s1c1
Sequence:CCGGGTGTCCATGCTCTCAGACAAACTCGAGTTTGTCTGAGAGCATGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-409s1c1
Sequence:CCGGGACTTACTCCATCGCTGAGAACTCGAGTTCTCAGCGATGGAGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-385s1c1
Sequence:CCGGCGAGTACATGCTGTCAATCTACTCGAGTAGATTGACAGCATGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001557.1-1939s1c1
Sequence:CCGGCGCATCTTGATTTGGTTGGTTCTCGAGAACCAACCAAATCAAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001557.1-2838s1c1
Sequence:CCGGGCCAAGTGTTACATTGAGCTTCTCGAGAAGCTCAATGTAACACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001557.1-470s1c1
Sequence:CCGGGCTAATACGATCACCAGCTTTCTCGAGAAAGCTGGTGATCGTATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001557.1-1940s1c1
Sequence:CCGGGCATCTTGATTTGGTTGGTTTCTCGAGAAACCAACCAAATCAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001557
GDF6 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 6
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-1375s1c1
Sequence:CCGGGACTCCCATCAGCATTCTATACTCGAGTATAGAATGCTGATGGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001557.1-394s1c1
Sequence:CCGGGCTGTCAATCTACAGGACTTACTCGAGTAAGTCCTGTAGATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-1369s1c1
Sequence:CCGGCAAATTGACTCCCATCAGCATCTCGAGATGCTGATGGGAGTCAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-455s1c1
Sequence:CCGGCAGTCTTCCAAGTCGGCTAATCTCGAGATTAGCCGACTTGGAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-958s1c1
Sequence:CCGGCAAGAACCTGTTCGCAGAGATCTCGAGATCTCTGCGAACAGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001557.1-554s1c1
Sequence:CCGGGTGTCCATGCTCTCAGACAAACTCGAGTTTGTCTGAGAGCATGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-409s1c1
Sequence:CCGGGACTTACTCCATCGCTGAGAACTCGAGTTCTCAGCGATGGAGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-385s1c1
Sequence:CCGGCGAGTACATGCTGTCAATCTACTCGAGTAGATTGACAGCATGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001557.1-1939s1c1
Sequence:CCGGCGCATCTTGATTTGGTTGGTTCTCGAGAACCAACCAAATCAAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001557.1-2838s1c1
Sequence:CCGGGCCAAGTGTTACATTGAGCTTCTCGAGAAGCTCAATGTAACACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001557.1-470s1c1
Sequence:CCGGGCTAATACGATCACCAGCTTTCTCGAGAAAGCTGGTGATCGTATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001557.1-1940s1c1
Sequence:CCGGGCATCTTGATTTGGTTGGTTTCTCGAGAAACCAACCAAATCAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001557
GDF6 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 6
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-1375s1c1
Sequence:CCGGGACTCCCATCAGCATTCTATACTCGAGTATAGAATGCTGATGGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001557.1-394s1c1
Sequence:CCGGGCTGTCAATCTACAGGACTTACTCGAGTAAGTCCTGTAGATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-1369s1c1
Sequence:CCGGCAAATTGACTCCCATCAGCATCTCGAGATGCTGATGGGAGTCAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-455s1c1
Sequence:CCGGCAGTCTTCCAAGTCGGCTAATCTCGAGATTAGCCGACTTGGAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-958s1c1
Sequence:CCGGCAAGAACCTGTTCGCAGAGATCTCGAGATCTCTGCGAACAGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001557.1-554s1c1
Sequence:CCGGGTGTCCATGCTCTCAGACAAACTCGAGTTTGTCTGAGAGCATGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-409s1c1
Sequence:CCGGGACTTACTCCATCGCTGAGAACTCGAGTTCTCAGCGATGGAGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001557.1-385s1c1
Sequence:CCGGCGAGTACATGCTGTCAATCTACTCGAGTAGATTGACAGCATGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001557.1-1939s1c1
Sequence:CCGGCGCATCTTGATTTGGTTGGTTCTCGAGAACCAACCAAATCAAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001557.1-2838s1c1
Sequence:CCGGGCCAAGTGTTACATTGAGCTTCTCGAGAAGCTCAATGTAACACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001557.1-470s1c1
Sequence:CCGGGCTAATACGATCACCAGCTTTCTCGAGAAAGCTGGTGATCGTATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001557.1-1940s1c1
Sequence:CCGGGCATCTTGATTTGGTTGGTTTCTCGAGAAACCAACCAAATCAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks