EMAIL THIS PAGE TO A FRIEND

GDF7

growth differentiation factor 7

74 Gene Product Result for
Synonyms: BMP12
UniProtKB ID: Q7Z4P5
Gene ID:
Human(151449) Summary: This gene encodes a member of the bone morphogenetic protein (BMP) family. BMPs belong to the transforming growth factor-beta superfamily of secreted signalling molecules that regulate diverse processes in growth, repair and embryonic development. In mouse, this gene functions as an inductive signal from the roof plate required for the specification of neuronal identity in the dorsal spinal cord. [provided by RefSeq, Jul 2008]
Mouse(238057) growth differentiation factor 7
Rat(252833) growth differentiation factor 7
Zebrafish(30642) growth/differentiation factor 7
cow(286859) growth differentiation factor 7
dog(482989) growth differentiation factor 7
chicken(428655) growth differentiation factor 7
naked mole-rat(101722616) growth differentiation factor 7
domestic guinea pig(101787430) growth differentiation factor 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182828 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013527 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013527 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013527 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182828 Rosetta Predictions human pricing
XM_001063724 Rosetta Predictions rat pricing
XM_001067529 Rosetta Predictions rat pricing
XM_001067581 Rosetta Predictions rat pricing
XM_345646 Rosetta Predictions rat pricing
NM_013527 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125764 predicted 1012
2 SASI_Hs01_00125765 predicted 1859
3 SASI_Hs01_00125766 predicted 1630
4 SASI_Hs01_00125767 predicted 930
5 SASI_Hs01_00125768 predicted 1710
6 SASI_Hs01_00125769 predicted 923
7 SASI_Hs01_00125770 predicted 962
8 SASI_Hs01_00125771 predicted 960
9 SASI_Hs01_00125772 predicted 1407
10 SASI_Hs01_00125773 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308110 predicted 1305
2 SASI_Rn02_00308111 predicted 1425
3 SASI_Rn02_00308112 predicted 645
4 SASI_Rn02_00308113 predicted 589
5 SASI_Rn02_00308114 predicted 616
6 SASI_Rn02_00308115 predicted 681
7 SASI_Rn02_00308116 predicted 609
8 SASI_Rn02_00308117 predicted 1348
9 SASI_Rn02_00308118 predicted 1398
10 SASI_Rn02_00308119 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321297 predicted 332
2 SASI_Rn02_00321298 predicted 1405
3 SASI_Rn02_00321299 predicted 352
4 SASI_Rn02_00321300 predicted 250
5 SASI_Rn02_00321301 predicted 386
6 SASI_Rn02_00321302 predicted 249
7 SASI_Rn02_00321303 predicted 327
8 SASI_Rn02_00321304 predicted 1340
9 SASI_Rn02_00321305 predicted 362
10 SASI_Rn02_00321306 predicted 1416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321464 predicted 351
2 SASI_Rn02_00321465 predicted 1407
3 SASI_Rn02_00321466 predicted 377
4 SASI_Rn02_00321467 predicted 267
5 SASI_Rn02_00321468 predicted 393
6 SASI_Rn02_00321469 predicted 263
7 SASI_Rn02_00321470 predicted 346
8 SASI_Rn02_00321471 predicted 1344
9 SASI_Rn02_00321472 predicted 1420
10 SASI_Rn02_00321473 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398583 predicted 1300
2 SASI_Rn02_00398584 predicted 1429
3 SASI_Rn02_00398585 predicted 640
4 SASI_Rn02_00398586 predicted 583
5 SASI_Rn02_00398587 predicted 607
6 SASI_Rn02_00398588 predicted 676
7 SASI_Rn02_00398589 predicted 606
8 SASI_Rn02_00398590 predicted 1348
9 SASI_Rn02_00398591 predicted 1401
10 SASI_Rn02_00398592 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115367 predicted 677
2 SASI_Mm01_00115368 predicted 232
3 SASI_Mm01_00115369 predicted 350
4 SASI_Mm01_00115370 predicted 349
5 SASI_Mm01_00115371 predicted 587
6 SASI_Mm01_00115372 predicted 636
7 SASI_Mm01_00115374 predicted 229
8 SASI_Mm01_00115375 predicted 413
9 SASI_Mm01_00115376 predicted 700
10 SASI_Mm02_00322222 predicted 263
11 SASI_Mm01_00115373 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182828
GDF7 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-1398s1c1
Sequence:CCGGGCAGAGGAAAGAGAGCTTATTCTCGAGAATAAGCTCTCTTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-1407s1c1
Sequence:CCGGAGAGAGCTTATTCCGGGAGATCTCGAGATCTCCCGGAATAAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-1002s1c1
Sequence:CCGGGTTCGACGTGTCCAGCCTTAACTCGAGTTAAGGCTGGACACGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-1497s1c1
Sequence:CCGGCGCGTCGCCAAGGGCAGTCATCTCGAGATGACTGCCCTTGGCGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-927s1c1
Sequence:CCGGCGCGGACACGATCACCGGCTTCTCGAGAAGCCGGTGATCGTGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182828.2-1629s21c1
Sequence:CCGGCAAGCCGTTGCACGTGGACTTCTCGAGAAGTCCACGTGCAACGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182828.2-843s21c1
Sequence:CCGGCCACTTCATGATGTCGCTTTACTCGAGTAAAGCGACATCATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182828
GDF7 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-1398s1c1
Sequence:CCGGGCAGAGGAAAGAGAGCTTATTCTCGAGAATAAGCTCTCTTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-1407s1c1
Sequence:CCGGAGAGAGCTTATTCCGGGAGATCTCGAGATCTCCCGGAATAAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-1002s1c1
Sequence:CCGGGTTCGACGTGTCCAGCCTTAACTCGAGTTAAGGCTGGACACGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-1497s1c1
Sequence:CCGGCGCGTCGCCAAGGGCAGTCATCTCGAGATGACTGCCCTTGGCGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-927s1c1
Sequence:CCGGCGCGGACACGATCACCGGCTTCTCGAGAAGCCGGTGATCGTGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182828.2-1629s21c1
Sequence:CCGGCAAGCCGTTGCACGTGGACTTCTCGAGAAGTCCACGTGCAACGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182828.2-843s21c1
Sequence:CCGGCCACTTCATGATGTCGCTTTACTCGAGTAAAGCGACATCATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182828
GDF7 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-1398s1c1
Sequence:CCGGGCAGAGGAAAGAGAGCTTATTCTCGAGAATAAGCTCTCTTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-1407s1c1
Sequence:CCGGAGAGAGCTTATTCCGGGAGATCTCGAGATCTCCCGGAATAAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-1002s1c1
Sequence:CCGGGTTCGACGTGTCCAGCCTTAACTCGAGTTAAGGCTGGACACGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-1497s1c1
Sequence:CCGGCGCGTCGCCAAGGGCAGTCATCTCGAGATGACTGCCCTTGGCGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182828.1-927s1c1
Sequence:CCGGCGCGGACACGATCACCGGCTTCTCGAGAAGCCGGTGATCGTGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182828.2-1629s21c1
Sequence:CCGGCAAGCCGTTGCACGTGGACTTCTCGAGAAGTCCACGTGCAACGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182828.2-843s21c1
Sequence:CCGGCCACTTCATGATGTCGCTTTACTCGAGTAAAGCGACATCATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013527
GDF7 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-1137s1c1
Sequence:CCGGGCCATTAGACTACGAGGCATACTCGAGTATGCCTCGTAGTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-1122s1c1
Sequence:CCGGCGACTGGATCATCGCGCCATTCTCGAGAATGGCGCGATGATCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-424s1c1
Sequence:CCGGGAAGCCGATGAGGTGGTGAATCTCGAGATTCACCACCTCATCGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-806s1c1
Sequence:CCGGCGCAAAGGAAAGAGAGTCTGTCTCGAGACAGACTCTCTTTCCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-276s1c1
Sequence:CCGGCCACTTCATGATGTCGCTTTACTCGAGTAAAGCGACATCATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013527.1-1085s21c1
Sequence:CCGGAGTCACTGCACGTGGACTTTACTCGAGTAAAGTCCACGTGCAGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013527.1-393s21c1
Sequence:CCGGGAGCTTCCTGTTCGACGTATCCTCGAGGATACGTCGAACAGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013527.1-1335s21c1
Sequence:CCGGCTACAAGCAGTACGAAGACATCTCGAGATGTCTTCGTACTGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013527.1-1309s21c1
Sequence:CCGGTACATCGATGCCGCCAACAACCTCGAGGTTGTTGGCGGCATCGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013527
GDF7 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-1137s1c1
Sequence:CCGGGCCATTAGACTACGAGGCATACTCGAGTATGCCTCGTAGTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-1122s1c1
Sequence:CCGGCGACTGGATCATCGCGCCATTCTCGAGAATGGCGCGATGATCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-424s1c1
Sequence:CCGGGAAGCCGATGAGGTGGTGAATCTCGAGATTCACCACCTCATCGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-806s1c1
Sequence:CCGGCGCAAAGGAAAGAGAGTCTGTCTCGAGACAGACTCTCTTTCCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-276s1c1
Sequence:CCGGCCACTTCATGATGTCGCTTTACTCGAGTAAAGCGACATCATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013527.1-1085s21c1
Sequence:CCGGAGTCACTGCACGTGGACTTTACTCGAGTAAAGTCCACGTGCAGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013527.1-393s21c1
Sequence:CCGGGAGCTTCCTGTTCGACGTATCCTCGAGGATACGTCGAACAGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013527.1-1335s21c1
Sequence:CCGGCTACAAGCAGTACGAAGACATCTCGAGATGTCTTCGTACTGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013527.1-1309s21c1
Sequence:CCGGTACATCGATGCCGCCAACAACCTCGAGGTTGTTGGCGGCATCGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013527
GDF7 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-1137s1c1
Sequence:CCGGGCCATTAGACTACGAGGCATACTCGAGTATGCCTCGTAGTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-1122s1c1
Sequence:CCGGCGACTGGATCATCGCGCCATTCTCGAGAATGGCGCGATGATCCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-424s1c1
Sequence:CCGGGAAGCCGATGAGGTGGTGAATCTCGAGATTCACCACCTCATCGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-806s1c1
Sequence:CCGGCGCAAAGGAAAGAGAGTCTGTCTCGAGACAGACTCTCTTTCCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013527.1-276s1c1
Sequence:CCGGCCACTTCATGATGTCGCTTTACTCGAGTAAAGCGACATCATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013527.1-1085s21c1
Sequence:CCGGAGTCACTGCACGTGGACTTTACTCGAGTAAAGTCCACGTGCAGTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013527.1-393s21c1
Sequence:CCGGGAGCTTCCTGTTCGACGTATCCTCGAGGATACGTCGAACAGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013527.1-1335s21c1
Sequence:CCGGCTACAAGCAGTACGAAGACATCTCGAGATGTCTTCGTACTGCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013527.1-1309s21c1
Sequence:CCGGTACATCGATGCCGCCAACAACCTCGAGGTTGTTGGCGGCATCGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks