EMAIL THIS PAGE TO A FRIEND

GDF9

growth differentiation factor 9

55 Gene Product Result for
UniProtKB ID: O60383, Q4VAW5
Gene ID:
Human(2661) Summary: Growth factors synthesized by ovarian somatic cells directly affect oocyte growth and function. Growth differentiation factor-9 (GDF9) is expressed in oocytes and is thought to be required for ovarian folliculogenesis. GDF9 is a member of the transforming growth factor-beta superfamily. [provided by RefSeq, Jul 2008]
Mouse(14566) growth differentiation factor 9
Rat(59304) growth differentiation factor 9
Goat(100860859) growth differentiation factor 9
sheep(100217402) growth differentiation factor 9
Domestic Rabbit(100328727) growth differentiation factor 9
domestic guinea pig(100735066) growth differentiation factor 9
naked mole-rat(101712897) growth differentiation factor 9
Zebrafish(497643) growth differentiation factor 9
dog(100313495) growth differentiation factor 9
chicken(404533) growth differentiation factor 9
domestic cat(100306942) growth differentiation factor 9
cow(282574) growth differentiation factor 9
Horse(100072822) growth differentiation factor 9
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008110 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008110 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008110 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005260 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053261 MISSION® esiRNA esiRNA human GDF9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005260 Rosetta Predictions human pricing
NM_021672 Rosetta Predictions rat pricing
NM_008110 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097288 predicted 831
2 SASI_Hs01_00097289 predicted 1371
3 SASI_Hs01_00097290 predicted 1319
4 SASI_Hs01_00097291 predicted 1438
5 SASI_Hs01_00097292 predicted 1079
6 SASI_Hs01_00097293 predicted 1053
7 SASI_Hs02_00339291 predicted 1539
8 SASI_Hs01_00097294 predicted 840
9 SASI_Hs01_00097295 predicted 992
10 SASI_Hs01_00097296 predicted 1574
11 SASI_Hs01_00097297 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042044 predicted 400
2 SASI_Rn01_00042045 predicted 877
3 SASI_Rn01_00042046 predicted 707
4 SASI_Rn01_00042047 predicted 1146
5 SASI_Rn01_00042048 predicted 462
6 SASI_Rn01_00042049 predicted 786
7 SASI_Rn01_00042050 predicted 441
8 SASI_Rn02_00262693 predicted 1015
9 SASI_Rn01_00042051 predicted 603
10 SASI_Rn01_00042053 predicted 660
11 SASI_Rn01_00042052 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182610 predicted 388
2 SASI_Mm01_00182611 predicted 1065
3 SASI_Mm01_00182612 predicted 1099
4 SASI_Mm02_00313164 predicted 834
5 SASI_Mm01_00182614 predicted 320
6 SASI_Mm01_00182615 predicted 726
7 SASI_Mm01_00182616 predicted 1087
8 SASI_Mm01_00182617 predicted 1411
9 SASI_Mm01_00182618 predicted 654
10 SASI_Mm01_00182619 predicted 639
11 SASI_Mm01_00182613 predicted 695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008110
GDF9 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008110.2-989s21c1
Sequence:CCGGCCGTGAAAGAGGAAGCTATTGCTCGAGCAATAGCTTCCTCTTTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008110.2-1598s21c1
Sequence:CCGGTGCAGTGTCCGTAGGTGTAAACTCGAGTTTACACCTACGGACACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008110.2-1283s21c1
Sequence:CCGGTGGTCCAGAATATAATCTATGCTCGAGCATAGATTATATTCTGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008110.1-1557s1c1
Sequence:CCGGCCAAGTGAAATGTAACTCATTCTCGAGAATGAGTTACATTTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008110.1-979s1c1
Sequence:CCGGGCCACTTCTTACAGCATCCTTCTCGAGAAGGATGCTGTAAGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008110.1-1054s1c1
Sequence:CCGGCCATGACTTCAGACTGAGTTTCTCGAGAAACTCAGTCTGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008110.1-345s1c1
Sequence:CCGGGCAGAAGTCACCTCTACAATACTCGAGTATTGTAGAGGTGACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008110.1-473s1c1
Sequence:CCGGGCCATGGAACACTTGCTCAAACTCGAGTTTGAGCAAGTGTTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008110
GDF9 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008110.2-989s21c1
Sequence:CCGGCCGTGAAAGAGGAAGCTATTGCTCGAGCAATAGCTTCCTCTTTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008110.2-1598s21c1
Sequence:CCGGTGCAGTGTCCGTAGGTGTAAACTCGAGTTTACACCTACGGACACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008110.2-1283s21c1
Sequence:CCGGTGGTCCAGAATATAATCTATGCTCGAGCATAGATTATATTCTGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008110.1-1557s1c1
Sequence:CCGGCCAAGTGAAATGTAACTCATTCTCGAGAATGAGTTACATTTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008110.1-979s1c1
Sequence:CCGGGCCACTTCTTACAGCATCCTTCTCGAGAAGGATGCTGTAAGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008110.1-1054s1c1
Sequence:CCGGCCATGACTTCAGACTGAGTTTCTCGAGAAACTCAGTCTGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008110.1-345s1c1
Sequence:CCGGGCAGAAGTCACCTCTACAATACTCGAGTATTGTAGAGGTGACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008110.1-473s1c1
Sequence:CCGGGCCATGGAACACTTGCTCAAACTCGAGTTTGAGCAAGTGTTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008110
GDF9 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008110.2-989s21c1
Sequence:CCGGCCGTGAAAGAGGAAGCTATTGCTCGAGCAATAGCTTCCTCTTTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008110.2-1598s21c1
Sequence:CCGGTGCAGTGTCCGTAGGTGTAAACTCGAGTTTACACCTACGGACACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008110.2-1283s21c1
Sequence:CCGGTGGTCCAGAATATAATCTATGCTCGAGCATAGATTATATTCTGGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008110.1-1557s1c1
Sequence:CCGGCCAAGTGAAATGTAACTCATTCTCGAGAATGAGTTACATTTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008110.1-979s1c1
Sequence:CCGGGCCACTTCTTACAGCATCCTTCTCGAGAAGGATGCTGTAAGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008110.1-1054s1c1
Sequence:CCGGCCATGACTTCAGACTGAGTTTCTCGAGAAACTCAGTCTGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008110.1-345s1c1
Sequence:CCGGGCAGAAGTCACCTCTACAATACTCGAGTATTGTAGAGGTGACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008110.1-473s1c1
Sequence:CCGGGCCATGGAACACTTGCTCAAACTCGAGTTTGAGCAAGTGTTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005260
GDF9 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005260.3-1555s21c1
Sequence:CCGGGATGGCTCAATTGCCTATAAACTCGAGTTTATAGGCAATTGAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005260.3-392s21c1
Sequence:CCGGGGTCCTTGCTGCAGCATATAGCTCGAGCTATATGCTGCAGCAAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-1065s1c1
Sequence:CCGGCCATGACTTTAGACTTAGCTTCTCGAGAAGCTAAGTCTAAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-511s1c1
Sequence:CCGGGCTGTCAAATGTGTGTGCAATCTCGAGATTGCACACACATTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-1017s1c1
Sequence:CCGGGAGTGAATACTTCAGACAATTCTCGAGAATTGTCTGAAGTATTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-406s1c1
Sequence:CCGGCCATCAGTGGAACTGCTATTTCTCGAGAAATAGCAGTTCCACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-830s1c1
Sequence:CCGGGCTGGTATTCCCTTCACTATACTCGAGTATAGTGAAGGGAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005260
GDF9 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005260.3-1555s21c1
Sequence:CCGGGATGGCTCAATTGCCTATAAACTCGAGTTTATAGGCAATTGAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005260.3-392s21c1
Sequence:CCGGGGTCCTTGCTGCAGCATATAGCTCGAGCTATATGCTGCAGCAAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-1065s1c1
Sequence:CCGGCCATGACTTTAGACTTAGCTTCTCGAGAAGCTAAGTCTAAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-511s1c1
Sequence:CCGGGCTGTCAAATGTGTGTGCAATCTCGAGATTGCACACACATTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-1017s1c1
Sequence:CCGGGAGTGAATACTTCAGACAATTCTCGAGAATTGTCTGAAGTATTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-406s1c1
Sequence:CCGGCCATCAGTGGAACTGCTATTTCTCGAGAAATAGCAGTTCCACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-830s1c1
Sequence:CCGGGCTGGTATTCCCTTCACTATACTCGAGTATAGTGAAGGGAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005260
GDF9 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005260.3-1555s21c1
Sequence:CCGGGATGGCTCAATTGCCTATAAACTCGAGTTTATAGGCAATTGAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005260.3-392s21c1
Sequence:CCGGGGTCCTTGCTGCAGCATATAGCTCGAGCTATATGCTGCAGCAAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-1065s1c1
Sequence:CCGGCCATGACTTTAGACTTAGCTTCTCGAGAAGCTAAGTCTAAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-511s1c1
Sequence:CCGGGCTGTCAAATGTGTGTGCAATCTCGAGATTGCACACACATTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-1017s1c1
Sequence:CCGGGAGTGAATACTTCAGACAATTCTCGAGAATTGTCTGAAGTATTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-406s1c1
Sequence:CCGGCCATCAGTGGAACTGCTATTTCTCGAGAAATAGCAGTTCCACTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005260.2-830s1c1
Sequence:CCGGGCTGGTATTCCCTTCACTATACTCGAGTATAGTGAAGGGAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks