EMAIL THIS PAGE TO A FRIEND

GDI1

GDP dissociation inhibitor 1

109 Gene Product Result for
Synonyms: 1A GDIL MRX41 MRX48 OPHN2 RABGD1A RABGDIA XAP-4
Gene ID:
Human(2664) Summary: GDP dissociation inhibitors are proteins that regulate the GDP-GTP exchange reaction of members of the rab family, small GTP-binding proteins of the ras superfamily, that are involved in vesicular trafficking of molecules between cellular organelles. GDIs slow the rate of dissociation of GDP from rab proteins and release GDP from membrane-bound rabs. GDI1 is expressed primarily in neural and sensory tissues. Mutations in GDI1 have been linked to X-linked nonspecific mental retardation. [provided by RefSeq, Jul 2008]
Mouse(14567) guanosine diphosphate (GDP) dissociation inhibitor 1
Rat(25183) GDP dissociation inhibitor 1
Zebrafish(554985) GDP dissociation inhibitor 1
cow(281188) GDP dissociation inhibitor 1
domestic cat(101084523) GDP dissociation inhibitor 1
dog(403819) GDP dissociation inhibitor 1
Thale Cress(819016) guanosine nucleotide diphosphate dissociation inhibitor 1
naked mole-rat(101705807) GDP dissociation inhibitor 1
domestic guinea pig(100723872) GDP dissociation inhibitor 1
sheep(100302074) GDP dissociation inhibitor 1
Domestic Rabbit(100328761) GDP dissociation inhibitor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001493 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010273 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010273 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010273 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001493 Rosetta Predictions human pricing
NM_017088 Rosetta Predictions rat pricing
NM_010273 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197198 predicted 566
2 SASI_Hs01_00197199 predicted 1572
3 SASI_Hs01_00197201 predicted 1496
4 SASI_Hs01_00197202 predicted 1330
5 SASI_Hs01_00197203 predicted 1469
6 SASI_Hs01_00197204 predicted 1498
7 SASI_Hs01_00197205 predicted 1464
8 SASI_Hs02_00331976 predicted 1649
9 SASI_Hs01_00197206 predicted 606
10 SASI_Hs01_00197207 predicted 1047
11 SASI_Hs01_00197200 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033284 predicted 742
2 SASI_Rn01_00033285 predicted 1289
3 SASI_Rn01_00033286 predicted 1064
4 SASI_Rn01_00033287 predicted 1350
5 SASI_Rn01_00033288 predicted 385
6 SASI_Rn01_00033289 predicted 787
7 SASI_Rn02_00261302 predicted 639
8 SASI_Rn01_00033291 predicted 1140
9 SASI_Rn01_00033292 predicted 716
10 SASI_Rn01_00033293 predicted 1069
11 SASI_Rn01_00033290 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318198 predicted 808
2 SASI_Mm01_00038923 predicted 1368
3 SASI_Mm01_00038924 predicted 1344
4 SASI_Mm01_00038925 predicted 1303
5 SASI_Mm01_00038926 predicted 761
6 SASI_Mm01_00038927 predicted 873
7 SASI_Mm01_00038928 predicted 660
8 SASI_Mm01_00038929 predicted 396
9 SASI_Mm01_00038930 predicted 658
10 SASI_Mm01_00038931 predicted 1358
11 SASI_Mm01_00038922 predicted 1079
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001493
GDI1 MISSION shRNA Bacterial Glycerol Stock
GDP dissociation inhibitor 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001493.1-746s1c1
Sequence:CCGGCCCATATTTATACCCGCTCTACTCGAGTAGAGCGGGTATAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001493.1-1659s1c1
Sequence:CCGGCCCTAATTCTTCTGCTCTGTTCTCGAGAACAGAGCAGAAGAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001493.1-1019s1c1
Sequence:CCGGCGCCAACTCCTGCCAAATAATCTCGAGATTATTTGGCAGGAGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001493.1-1386s1c1
Sequence:CCGGCGCAAACAGAACGACGTCTTTCTCGAGAAAGACGTCGTTCTGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001493.1-338s1c1
Sequence:CCGGGCTGGTAAAGATGCTACTGTACTCGAGTACAGTAGCATCTTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001493
GDI1 MISSION shRNA shRNA Plasmid DNA
GDP dissociation inhibitor 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001493.1-746s1c1
Sequence:CCGGCCCATATTTATACCCGCTCTACTCGAGTAGAGCGGGTATAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001493.1-1659s1c1
Sequence:CCGGCCCTAATTCTTCTGCTCTGTTCTCGAGAACAGAGCAGAAGAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001493.1-1019s1c1
Sequence:CCGGCGCCAACTCCTGCCAAATAATCTCGAGATTATTTGGCAGGAGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001493.1-1386s1c1
Sequence:CCGGCGCAAACAGAACGACGTCTTTCTCGAGAAAGACGTCGTTCTGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001493.1-338s1c1
Sequence:CCGGGCTGGTAAAGATGCTACTGTACTCGAGTACAGTAGCATCTTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001493
GDI1 MISSION shRNA Lentiviral Transduction Particles
GDP dissociation inhibitor 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001493.1-746s1c1
Sequence:CCGGCCCATATTTATACCCGCTCTACTCGAGTAGAGCGGGTATAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001493.1-1659s1c1
Sequence:CCGGCCCTAATTCTTCTGCTCTGTTCTCGAGAACAGAGCAGAAGAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001493.1-1019s1c1
Sequence:CCGGCGCCAACTCCTGCCAAATAATCTCGAGATTATTTGGCAGGAGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001493.1-1386s1c1
Sequence:CCGGCGCAAACAGAACGACGTCTTTCTCGAGAAAGACGTCGTTCTGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001493.1-338s1c1
Sequence:CCGGGCTGGTAAAGATGCTACTGTACTCGAGTACAGTAGCATCTTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010273
VALIDATED
GDI1 MISSION shRNA Bacterial Glycerol Stock
GDP dissociation inhibitor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010273.1-1906s1c1
Sequence:CCGGCCACTGCTCTTAGTCCCAAATCTCGAGATTTGGGACTAAGAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010273.1-400s1c1
Sequence:CCGGGCTGGTAAAGATGCTACTATACTCGAGTATAGTAGCATCTTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010273.1-647s1c1
Sequence:CCGGCGTGATGTCTACCGGAAGTTTCTCGAGAAACTTCCGGTAGACATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010273.1-857s1c1
Sequence:CCGGGCCAGATTGAGTGCCATCTATCTCGAGATAGATGGCACTCAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010273.1-742s1c1
Sequence:CCGGGCCCTGTCTTGAGACTATTAACTCGAGTTAATAGTCTCAAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010273.3-741s21c1
Sequence:CCGGGCCCTGTCTTGAGACTATTAACTCGAGTTAATAGTCTCAAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010273.3-527s21c1
Sequence:CCGGCTAATCTGATGGGCATGTTTGCTCGAGCAAACATGCCCATCAGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010273.3-1079s21c1
Sequence:CCGGATGCCAATTCCTGCCAAATTACTCGAGTAATTTGGCAGGAATTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010273.3-1905s21c1
Sequence:CCGGCCACTGCTCTTAGTCCCAAATCTCGAGATTTGGGACTAAGAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010273.3-646s21c1
Sequence:CCGGCGTGATGTCTACCGGAAGTTTCTCGAGAAACTTCCGGTAGACATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010273
VALIDATED
GDI1 MISSION shRNA shRNA Plasmid DNA
GDP dissociation inhibitor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010273.1-1906s1c1
Sequence:CCGGCCACTGCTCTTAGTCCCAAATCTCGAGATTTGGGACTAAGAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010273.1-400s1c1
Sequence:CCGGGCTGGTAAAGATGCTACTATACTCGAGTATAGTAGCATCTTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010273.1-647s1c1
Sequence:CCGGCGTGATGTCTACCGGAAGTTTCTCGAGAAACTTCCGGTAGACATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010273.1-857s1c1
Sequence:CCGGGCCAGATTGAGTGCCATCTATCTCGAGATAGATGGCACTCAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010273.1-742s1c1
Sequence:CCGGGCCCTGTCTTGAGACTATTAACTCGAGTTAATAGTCTCAAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010273.3-741s21c1
Sequence:CCGGGCCCTGTCTTGAGACTATTAACTCGAGTTAATAGTCTCAAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010273.3-527s21c1
Sequence:CCGGCTAATCTGATGGGCATGTTTGCTCGAGCAAACATGCCCATCAGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010273.3-1079s21c1
Sequence:CCGGATGCCAATTCCTGCCAAATTACTCGAGTAATTTGGCAGGAATTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010273.3-1905s21c1
Sequence:CCGGCCACTGCTCTTAGTCCCAAATCTCGAGATTTGGGACTAAGAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010273.3-646s21c1
Sequence:CCGGCGTGATGTCTACCGGAAGTTTCTCGAGAAACTTCCGGTAGACATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010273
VALIDATED
GDI1 MISSION shRNA Lentiviral Transduction Particles
GDP dissociation inhibitor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010273.1-1906s1c1
Sequence:CCGGCCACTGCTCTTAGTCCCAAATCTCGAGATTTGGGACTAAGAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010273.1-400s1c1
Sequence:CCGGGCTGGTAAAGATGCTACTATACTCGAGTATAGTAGCATCTTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010273.1-647s1c1
Sequence:CCGGCGTGATGTCTACCGGAAGTTTCTCGAGAAACTTCCGGTAGACATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010273.1-857s1c1
Sequence:CCGGGCCAGATTGAGTGCCATCTATCTCGAGATAGATGGCACTCAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010273.1-742s1c1
Sequence:CCGGGCCCTGTCTTGAGACTATTAACTCGAGTTAATAGTCTCAAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010273.3-741s21c1
Sequence:CCGGGCCCTGTCTTGAGACTATTAACTCGAGTTAATAGTCTCAAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010273.3-527s21c1
Sequence:CCGGCTAATCTGATGGGCATGTTTGCTCGAGCAAACATGCCCATCAGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010273.3-1079s21c1
Sequence:CCGGATGCCAATTCCTGCCAAATTACTCGAGTAATTTGGCAGGAATTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010273.3-1905s21c1
Sequence:CCGGCCACTGCTCTTAGTCCCAAATCTCGAGATTTGGGACTAAGAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010273.3-646s21c1
Sequence:CCGGCGTGATGTCTACCGGAAGTTTCTCGAGAAACTTCCGGTAGACATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks