EMAIL THIS PAGE TO A FRIEND

GDI2

GDP dissociation inhibitor 2

114 Gene Product Result for
Synonyms: RABGDIB
UniProtKB ID: P50395, O43928, Q5SX88, Q9UQM6
Gene ID:
Human(2665) Summary: GDP dissociation inhibitors are proteins that regulate the GDP-GTP exchange reaction of members of the rab family, small GTP-binding proteins of the ras superfamily, that are involved in vesicular trafficking of molecules between cellular organelles. GDIs slow the rate of dissociation of GDP from rab proteins and release GDP from membrane-bound rabs. GDI2 is ubiquitously expressed. The GDI2 gene contains many repetitive elements indicating that it may be prone to inversion/deletion rearrangements. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(14569) guanosine diphosphate (GDP) dissociation inhibitor 2
Rat(29662) GDP dissociation inhibitor 2
sheep(100302068) GDP dissociation inhibitor 2
domestic guinea pig(100728062) GDP dissociation inhibitor 2
Zebrafish(323765) GDP dissociation inhibitor 2
chicken(395854) GDP dissociation inhibitor 2
cow(509832) GDP dissociation inhibitor 2
domestic cat(101081735) GDP dissociation inhibitor 2
dog(403818) GDP dissociation inhibitor 2
Thale Cress(825162) RAB GDP dissociation inhibitor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001494 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008112 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008112 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008112 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109311 MISSION® esiRNA esiRNA human GDI2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001115156 Rosetta Predictions human pricing
NM_001494 Rosetta Predictions human pricing
NM_017276 Rosetta Predictions rat pricing
NM_008112 Rosetta Predictions mouse pricing
XM_001052621 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326986 predicted 749
2 SASI_Hs02_00326987 predicted 1268
3 SASI_Hs02_00326988 predicted 1354
4 SASI_Hs02_00326989 predicted 1458
5 SASI_Hs02_00326990 predicted 1343
6 SASI_Hs02_00326991 predicted 765
7 SASI_Hs02_00326992 predicted 1462
8 SASI_Hs02_00326993 predicted 764
9 SASI_Hs02_00326994 predicted 753
10 SASI_Hs02_00326995 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331977 predicted 884
2 SASI_Hs02_00331978 predicted 1403
3 SASI_Hs02_00331979 predicted 1490
4 SASI_Hs02_00331980 predicted 1589
5 SASI_Hs02_00331981 predicted 1483
6 SASI_Hs02_00331982 predicted 900
7 SASI_Hs02_00331983 predicted 1593
8 SASI_Hs02_00331984 predicted 896
9 SASI_Hs02_00331985 predicted 886
10 SASI_Hs01_00038149 predicted 531
11 SASI_Hs01_00038150 predicted 231
12 SASI_Hs01_00038151 predicted 422
13 SASI_Hs01_00038152 predicted 547
14 SASI_Hs01_00038153 predicted 882
15 SASI_Hs01_00038154 predicted 1325
16 SASI_Hs01_00038155 predicted 504
17 SASI_Hs01_00038156 predicted 573
18 SASI_Hs01_00038157 predicted 477
19 SASI_Hs01_00038158 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107765 predicted 983
2 SASI_Rn01_00107766 predicted 1401
3 SASI_Rn01_00107767 predicted 706
4 SASI_Rn01_00107768 predicted 769
5 SASI_Rn01_00107769 predicted 443
6 SASI_Rn01_00107770 predicted 1323
7 SASI_Rn01_00107771 predicted 697
8 SASI_Rn01_00107772 predicted 925
9 SASI_Rn01_00107773 predicted 1155
10 SASI_Rn01_00107774 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313165 predicted 1522
2 SASI_Mm02_00313166 predicted 925
3 SASI_Mm02_00313167 predicted 1553
4 SASI_Mm02_00313168 predicted 1240
5 SASI_Mm02_00313169 predicted 1339
6 SASI_Mm02_00313170 predicted 572
7 SASI_Mm02_00313171 predicted 636
8 SASI_Mm02_00313172 predicted 1381
9 SASI_Mm02_00313173 predicted 352
10 SASI_Mm02_00313174 predicted 856
11 SASI_Mm01_00074749 predicted 2942
12 SASI_Mm01_00074750 predicted 2991
13 SASI_Mm01_00074751 predicted 3507
14 SASI_Mm01_00074752 predicted 2489
15 SASI_Mm01_00074753 predicted 3705
16 SASI_Mm01_00074754 predicted 2743
17 SASI_Mm01_00074755 predicted 2541
18 SASI_Mm01_00074756 predicted 3458
19 SASI_Mm01_00074757 predicted 2897
20 SASI_Mm01_00074758 predicted 2903
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269458 predicted 673
2 SASI_Mm01_00269459 predicted 731
3 SASI_Mm01_00269460 predicted 470
4 SASI_Mm01_00269461 predicted 633
5 SASI_Mm01_00269462 predicted 641
6 SASI_Mm01_00269463 predicted 904
7 SASI_Mm01_00269464 predicted 884
8 SASI_Mm01_00269465 predicted 765
9 SASI_Mm01_00269466 predicted 591
10 SASI_Mm01_00269467 predicted 477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001494
VALIDATED
GDI2 MISSION shRNA Bacterial Glycerol Stock
GDP dissociation inhibitor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001494.3-1825s21c1
Sequence:CCGGACCACATTCTGTTCAATTTAACTCGAGTTAAATTGAACAGAATGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001494.3-339s21c1
Sequence:CCGGATGTATCCTGTCAGGTATAATCTCGAGATTATACCTGACAGGATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001494.3-880s21c1
Sequence:CCGGTACTTAGATCAACCGTGTTATCTCGAGATAACACGGTTGATCTAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001494.3-817s21c1
Sequence:CCGGGATTTGGGTCAAGACGTTATACTCGAGTATAACGTCTTGACCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-819s1c1
Sequence:CCGGCCATACCTTTATCCACTCTATCTCGAGATAGAGTGGATAAAGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-384s1c1
Sequence:CCGGCCCAAGTTCCTTATGGCTAATCTCGAGATTAGCCATAAGGAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-1103s1c1
Sequence:CCGGCCAGATCATTATTCCACAGAACTCGAGTTCTGTGGAATAATGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-1458s1c1
Sequence:CCGGCGCAAGAAGAATGACATCTATCTCGAGATAGATGTCATTCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-269s1c1
Sequence:CCGGCGGAGGAGAAAGTGCATCTATCTCGAGATAGATGCACTTTCTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001494
VALIDATED
GDI2 MISSION shRNA shRNA Plasmid DNA
GDP dissociation inhibitor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001494.3-1825s21c1
Sequence:CCGGACCACATTCTGTTCAATTTAACTCGAGTTAAATTGAACAGAATGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001494.3-339s21c1
Sequence:CCGGATGTATCCTGTCAGGTATAATCTCGAGATTATACCTGACAGGATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001494.3-880s21c1
Sequence:CCGGTACTTAGATCAACCGTGTTATCTCGAGATAACACGGTTGATCTAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001494.3-817s21c1
Sequence:CCGGGATTTGGGTCAAGACGTTATACTCGAGTATAACGTCTTGACCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-819s1c1
Sequence:CCGGCCATACCTTTATCCACTCTATCTCGAGATAGAGTGGATAAAGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-384s1c1
Sequence:CCGGCCCAAGTTCCTTATGGCTAATCTCGAGATTAGCCATAAGGAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-1103s1c1
Sequence:CCGGCCAGATCATTATTCCACAGAACTCGAGTTCTGTGGAATAATGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-1458s1c1
Sequence:CCGGCGCAAGAAGAATGACATCTATCTCGAGATAGATGTCATTCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-269s1c1
Sequence:CCGGCGGAGGAGAAAGTGCATCTATCTCGAGATAGATGCACTTTCTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001494
VALIDATED
GDI2 MISSION shRNA Lentiviral Transduction Particles
GDP dissociation inhibitor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001494.3-1825s21c1
Sequence:CCGGACCACATTCTGTTCAATTTAACTCGAGTTAAATTGAACAGAATGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001494.3-339s21c1
Sequence:CCGGATGTATCCTGTCAGGTATAATCTCGAGATTATACCTGACAGGATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001494.3-880s21c1
Sequence:CCGGTACTTAGATCAACCGTGTTATCTCGAGATAACACGGTTGATCTAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001494.3-817s21c1
Sequence:CCGGGATTTGGGTCAAGACGTTATACTCGAGTATAACGTCTTGACCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-819s1c1
Sequence:CCGGCCATACCTTTATCCACTCTATCTCGAGATAGAGTGGATAAAGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-384s1c1
Sequence:CCGGCCCAAGTTCCTTATGGCTAATCTCGAGATTAGCCATAAGGAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-1103s1c1
Sequence:CCGGCCAGATCATTATTCCACAGAACTCGAGTTCTGTGGAATAATGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-1458s1c1
Sequence:CCGGCGCAAGAAGAATGACATCTATCTCGAGATAGATGTCATTCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001494.2-269s1c1
Sequence:CCGGCGGAGGAGAAAGTGCATCTATCTCGAGATAGATGCACTTTCTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008112
VALIDATED
GDI2 MISSION shRNA Bacterial Glycerol Stock
GDP dissociation inhibitor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008112.2-2839s1c1
Sequence:CCGGCGCATTATGTTTAGGTTGAAACTCGAGTTTCAACCTAAACATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008112.2-834s1c1
Sequence:CCGGCCGTACCTGTATCCGCTTTATCTCGAGATAAAGCGGATACAGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008112.2-1207s1c1
Sequence:CCGGGCAAGTATATTGCCATTGTAACTCGAGTTACAATGGCAATATACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008112.2-1322s1c1
Sequence:CCGGCCTCTTTGTACCTAAAGATTTCTCGAGAAATCTTTAGGTACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008112.2-630s1c1
Sequence:CCGGCCTAGAACTTTCGAGGGTGTTCTCGAGAACACCCTCGAAAGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008112
VALIDATED
GDI2 MISSION shRNA shRNA Plasmid DNA
GDP dissociation inhibitor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008112.2-2839s1c1
Sequence:CCGGCGCATTATGTTTAGGTTGAAACTCGAGTTTCAACCTAAACATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008112.2-834s1c1
Sequence:CCGGCCGTACCTGTATCCGCTTTATCTCGAGATAAAGCGGATACAGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008112.2-1207s1c1
Sequence:CCGGGCAAGTATATTGCCATTGTAACTCGAGTTACAATGGCAATATACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008112.2-1322s1c1
Sequence:CCGGCCTCTTTGTACCTAAAGATTTCTCGAGAAATCTTTAGGTACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008112.2-630s1c1
Sequence:CCGGCCTAGAACTTTCGAGGGTGTTCTCGAGAACACCCTCGAAAGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008112
VALIDATED
GDI2 MISSION shRNA Lentiviral Transduction Particles
GDP dissociation inhibitor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008112.2-2839s1c1
Sequence:CCGGCGCATTATGTTTAGGTTGAAACTCGAGTTTCAACCTAAACATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008112.2-834s1c1
Sequence:CCGGCCGTACCTGTATCCGCTTTATCTCGAGATAAAGCGGATACAGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008112.2-1207s1c1
Sequence:CCGGGCAAGTATATTGCCATTGTAACTCGAGTTACAATGGCAATATACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008112.2-1322s1c1
Sequence:CCGGCCTCTTTGTACCTAAAGATTTCTCGAGAAATCTTTAGGTACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008112.2-630s1c1
Sequence:CCGGCCTAGAACTTTCGAGGGTGTTCTCGAGAACACCCTCGAAAGTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks