EMAIL THIS PAGE TO A FRIEND

GDNF

glial cell derived neurotrophic factor

124 Gene Product Result for
Synonyms: ATF1 ATF2 HFB1-GDNF HSCR3
Gene ID:
Human(2668) Summary: This gene encodes a highly conserved neurotrophic factor. The recombinant form of this protein was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. The encoded protein is processed to a mature secreted form that exists as a homodimer. The mature form of the protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene may be associated with Hirschsprung disease. [provided by RefSeq, Jun 2010]
Mouse(14573) glial cell line derived neurotrophic factor
Rat(25453) glial cell derived neurotrophic factor
sheep(101117619) glial cell derived neurotrophic factor
domestic guinea pig(100717276) glial cell derived neurotrophic factor
naked mole-rat(101700544) glial cell derived neurotrophic factor
chicken(395569) glial cell derived neurotrophic factor
cow(386587) glial cell derived neurotrophic factor
Horse(100067053) glial cell derived neurotrophic factor
domestic cat(101097871) glial cell derived neurotrophic factor
dog(489224) glial cell derived neurotrophic factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000514 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141321 MISSION® esiRNA esiRNA human GDNF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000514 Rosetta Predictions human pricing
NM_199231 Rosetta Predictions human pricing
NM_199234 Rosetta Predictions human pricing
NM_019139 Rosetta Predictions rat pricing
NM_010275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077838 predicted 581
2 SASI_Hs01_00077839 predicted 331
3 SASI_Hs01_00077840 predicted 542
4 SASI_Hs01_00077841 predicted 368
5 SASI_Hs01_00077842 predicted 438
6 SASI_Hs01_00077843 predicted 354
7 SASI_Hs01_00077844 predicted 441
8 SASI_Hs01_00077845 predicted 344
9 SASI_Hs01_00077846 predicted 339
10 SASI_Hs01_00077847 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100952 predicted 342
2 SASI_Hs01_00100953 predicted 420
3 SASI_Hs01_00100954 predicted 390
4 SASI_Hs01_00100955 predicted 208
5 SASI_Hs01_00100956 predicted 215
6 SASI_Hs01_00100957 predicted 288
7 SASI_Hs01_00100958 predicted 204
8 SASI_Hs01_00100959 predicted 293
9 SASI_Hs01_00100960 predicted 309
10 SASI_Hs02_00372675 predicted 215
11 SASI_Hs01_00100961 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372676 predicted 64
2 SASI_Hs01_00045159 predicted 349
3 SASI_Hs01_00045160 predicted 311
4 SASI_Hs01_00045161 predicted 152
5 SASI_Hs01_00045162 predicted 366
6 SASI_Hs01_00045163 predicted 121
7 SASI_Hs01_00045164 predicted 227
8 SASI_Hs01_00045165 predicted 348
9 SASI_Hs01_00045166 predicted 351
10 SASI_Hs01_00045168 predicted 220
11 SASI_Hs01_00045167 predicted 125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121525 predicted 456
2 SASI_Rn01_00121526 predicted 409
3 SASI_Rn01_00121527 predicted 394
4 SASI_Rn01_00121528 predicted 427
5 SASI_Rn01_00121529 predicted 198
6 SASI_Rn01_00121530 predicted 454
7 SASI_Rn01_00121531 predicted 341
8 SASI_Rn01_00121532 predicted 456
9 SASI_Rn01_00121533 predicted 218
10 SASI_Rn01_00121534 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032463 predicted 708
2 SASI_Mm01_00032464 predicted 511
3 SASI_Mm01_00032465 predicted 723
4 SASI_Mm01_00032466 predicted 704
5 SASI_Mm01_00032467 predicted 626
6 SASI_Mm01_00032468 predicted 735
7 SASI_Mm01_00032469 predicted 419
8 SASI_Mm02_00318201 predicted 785
9 SASI_Mm01_00032471 predicted 543
10 SASI_Mm01_00032472 predicted 1056
11 SASI_Mm01_00032470 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000514
GDNF MISSION shRNA Bacterial Glycerol Stock
glial cell derived neurotrophic factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-654s1c1
Sequence:CCGGGCTGAGACAACGTACGACAAACTCGAGTTTGTCGTACGTTGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-553s1c1
Sequence:CCGGGTGTCTTAACTGCAATACATTCTCGAGAATGTATTGCAGTTAAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-337s1c1
Sequence:CCGGCGCTGAGCAGTGACTCAAATACTCGAGTATTTGAGTCACTGCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-603s1c1
Sequence:CCGGGAAACCAAGGAGGAACTGATTCTCGAGAATCAGTTCCTCCTTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-380s1c1
Sequence:CCGGGTTCGATGATGTCATGGATTTCTCGAGAAATCCATGACATCATCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000514.2-457s21c1
Sequence:CCGGTTCCTAGAAGAGAGCGGAATCCTCGAGGATTCCGCTCTCTTCTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000514.2-434s21c1
Sequence:CCGGACCAGATAAACAAATGGCAGTCTCGAGACTGCCATTTGTTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000514.2-625s21c1
Sequence:CCGGTTAGGTACTGCAGCGGCTCTTCTCGAGAAGAGCCGCTGCAGTACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000514
GDNF MISSION shRNA shRNA Plasmid DNA
glial cell derived neurotrophic factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-654s1c1
Sequence:CCGGGCTGAGACAACGTACGACAAACTCGAGTTTGTCGTACGTTGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-553s1c1
Sequence:CCGGGTGTCTTAACTGCAATACATTCTCGAGAATGTATTGCAGTTAAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-337s1c1
Sequence:CCGGCGCTGAGCAGTGACTCAAATACTCGAGTATTTGAGTCACTGCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-603s1c1
Sequence:CCGGGAAACCAAGGAGGAACTGATTCTCGAGAATCAGTTCCTCCTTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-380s1c1
Sequence:CCGGGTTCGATGATGTCATGGATTTCTCGAGAAATCCATGACATCATCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000514.2-457s21c1
Sequence:CCGGTTCCTAGAAGAGAGCGGAATCCTCGAGGATTCCGCTCTCTTCTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000514.2-434s21c1
Sequence:CCGGACCAGATAAACAAATGGCAGTCTCGAGACTGCCATTTGTTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000514.2-625s21c1
Sequence:CCGGTTAGGTACTGCAGCGGCTCTTCTCGAGAAGAGCCGCTGCAGTACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000514
GDNF MISSION shRNA Lentiviral Transduction Particles
glial cell derived neurotrophic factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-654s1c1
Sequence:CCGGGCTGAGACAACGTACGACAAACTCGAGTTTGTCGTACGTTGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-553s1c1
Sequence:CCGGGTGTCTTAACTGCAATACATTCTCGAGAATGTATTGCAGTTAAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-337s1c1
Sequence:CCGGCGCTGAGCAGTGACTCAAATACTCGAGTATTTGAGTCACTGCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-603s1c1
Sequence:CCGGGAAACCAAGGAGGAACTGATTCTCGAGAATCAGTTCCTCCTTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000514.2-380s1c1
Sequence:CCGGGTTCGATGATGTCATGGATTTCTCGAGAAATCCATGACATCATCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000514.2-457s21c1
Sequence:CCGGTTCCTAGAAGAGAGCGGAATCCTCGAGGATTCCGCTCTCTTCTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000514.2-434s21c1
Sequence:CCGGACCAGATAAACAAATGGCAGTCTCGAGACTGCCATTTGTTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000514.2-625s21c1
Sequence:CCGGTTAGGTACTGCAGCGGCTCTTCTCGAGAAGAGCCGCTGCAGTACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010275
VALIDATED
GDNF MISSION shRNA Bacterial Glycerol Stock
glial cell derived neurotrophic factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010275.1-2171s1c1
Sequence:CCGGCCCTGCTTTCTATCTGCTAAACTCGAGTTTAGCAGATAGAAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010275.1-268s1c1
Sequence:CCGGGCTGACCAGTGACTCCAATATCTCGAGATATTGGAGTCACTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010275.1-119s1c1
Sequence:CCGGCGGGACTCTAAGATGAAGTTACTCGAGTAACTTCATCTTAGAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010275.1-428s1c1
Sequence:CCGGCCAGAGAATTCCAGAGGGAAACTCGAGTTTCCCTCTGGAATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010275.1-584s1c1
Sequence:CCGGGCCGAGACAATGTATGACAAACTCGAGTTTGTCATACATTGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010275.2-708s21c1
Sequence:CCGGACAACCTGGTTTACCATATTCCTCGAGGAATATGGTAAACCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010275.2-282s21c1
Sequence:CCGGCCAATATGCCTGAAGATTATCCTCGAGGATAATCTTCAGGCATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010275.2-120s21c1
Sequence:CCGGGGGACTCTAAGATGAAGTTATCTCGAGATAACTTCATCTTAGAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010275.2-543s21c1
Sequence:CCGGAGGAACTGATCTTTCGATATTCTCGAGAATATCGAAAGATCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010275.2-799s21c1
Sequence:CCGGCCTGCTACAGTGCGAAGAAAGCTCGAGCTTTCTTCGCACTGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010275
VALIDATED
GDNF MISSION shRNA shRNA Plasmid DNA
glial cell derived neurotrophic factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010275.1-2171s1c1
Sequence:CCGGCCCTGCTTTCTATCTGCTAAACTCGAGTTTAGCAGATAGAAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010275.1-268s1c1
Sequence:CCGGGCTGACCAGTGACTCCAATATCTCGAGATATTGGAGTCACTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010275.1-119s1c1
Sequence:CCGGCGGGACTCTAAGATGAAGTTACTCGAGTAACTTCATCTTAGAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010275.1-428s1c1
Sequence:CCGGCCAGAGAATTCCAGAGGGAAACTCGAGTTTCCCTCTGGAATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010275.1-584s1c1
Sequence:CCGGGCCGAGACAATGTATGACAAACTCGAGTTTGTCATACATTGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010275.2-708s21c1
Sequence:CCGGACAACCTGGTTTACCATATTCCTCGAGGAATATGGTAAACCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010275.2-282s21c1
Sequence:CCGGCCAATATGCCTGAAGATTATCCTCGAGGATAATCTTCAGGCATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010275.2-120s21c1
Sequence:CCGGGGGACTCTAAGATGAAGTTATCTCGAGATAACTTCATCTTAGAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010275.2-543s21c1
Sequence:CCGGAGGAACTGATCTTTCGATATTCTCGAGAATATCGAAAGATCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010275.2-799s21c1
Sequence:CCGGCCTGCTACAGTGCGAAGAAAGCTCGAGCTTTCTTCGCACTGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010275
VALIDATED
GDNF MISSION shRNA Lentiviral Transduction Particles
glial cell derived neurotrophic factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010275.1-2171s1c1
Sequence:CCGGCCCTGCTTTCTATCTGCTAAACTCGAGTTTAGCAGATAGAAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010275.1-268s1c1
Sequence:CCGGGCTGACCAGTGACTCCAATATCTCGAGATATTGGAGTCACTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010275.1-119s1c1
Sequence:CCGGCGGGACTCTAAGATGAAGTTACTCGAGTAACTTCATCTTAGAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010275.1-428s1c1
Sequence:CCGGCCAGAGAATTCCAGAGGGAAACTCGAGTTTCCCTCTGGAATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010275.1-584s1c1
Sequence:CCGGGCCGAGACAATGTATGACAAACTCGAGTTTGTCATACATTGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010275.2-708s21c1
Sequence:CCGGACAACCTGGTTTACCATATTCCTCGAGGAATATGGTAAACCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010275.2-282s21c1
Sequence:CCGGCCAATATGCCTGAAGATTATCCTCGAGGATAATCTTCAGGCATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010275.2-120s21c1
Sequence:CCGGGGGACTCTAAGATGAAGTTATCTCGAGATAACTTCATCTTAGAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010275.2-543s21c1
Sequence:CCGGAGGAACTGATCTTTCGATATTCTCGAGAATATCGAAAGATCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010275.2-799s21c1
Sequence:CCGGCCTGCTACAGTGCGAAGAAAGCTCGAGCTTTCTTCGCACTGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks