EMAIL THIS PAGE TO A FRIEND

GDPD1

glycerophosphodiester phosphodiesterase domain containing 1

68 Gene Product Result for
Synonyms: GDE4
UniProtKB ID: Q8N9F7, A8W735, Q56VR1, Q8N4E3
Gene ID:
Human(284161) Summary: This gene encodes a member of the glycerophosphodiester phosphodiesterase family of enzymes that catalyze the hydrolysis of deacylated glycerophospholipids to glycerol phosphate and alcohol. The encoded protein is localized to the cytoplasm and concentrates near the perinuclear region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(66569) glycerophosphodiester phosphodiesterase domain containing 1
Rat(303407) glycerophosphodiester phosphodiesterase domain containing 1
Zebrafish(445504) glycerophosphodiester phosphodiesterase domain containing 1
chicken(417631) glycerophosphodiester phosphodiesterase domain containing 1
dog(491117) glycerophosphodiester phosphodiesterase domain containing 1
cow(615890) glycerophosphodiester phosphodiesterase domain containing 1
domestic cat(101081586) glycerophosphodiester phosphodiesterase domain containing 1
naked mole-rat(101718687) glycerophosphodiester phosphodiesterase domain containing 1
domestic guinea pig(100720703) glycerophosphodiester phosphodiesterase domain containing 1
sheep(101103993) glycerophosphodiester phosphodiesterase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301346 ANTI-GDPD1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182569 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182569 Rosetta Predictions human pricing
NM_001044238 Rosetta Predictions rat pricing
NM_025638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154944 predicted 472
2 SASI_Hs01_00154945 predicted 386
3 SASI_Hs02_00370699 predicted 335
4 SASI_Hs01_00154946 predicted 676
5 SASI_Hs01_00154947 predicted 785
6 SASI_Hs01_00154948 predicted 625
7 SASI_Hs01_00154949 predicted 573
8 SASI_Hs01_00154950 predicted 347
9 SASI_Hs01_00154951 predicted 704
10 SASI_Hs01_00154952 predicted 534
11 SASI_Hs01_00154953 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205107 predicted 312
2 SASI_Rn02_00205108 predicted 965
3 SASI_Rn02_00205109 predicted 641
4 SASI_Rn02_00205110 predicted 244
5 SASI_Rn02_00205111 predicted 266
6 SASI_Rn02_00205112 predicted 707
7 SASI_Rn02_00205113 predicted 956
8 SASI_Rn02_00205114 predicted 411
9 SASI_Rn02_00205115 predicted 399
10 SASI_Rn02_00205116 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098460 predicted 1251
2 SASI_Mm02_00328718 predicted 267
3 SASI_Mm01_00098461 predicted 290
4 SASI_Mm01_00098462 predicted 1256
5 SASI_Mm01_00098463 predicted 1274
6 SASI_Mm01_00098464 predicted 1240
7 SASI_Mm01_00098465 predicted 318
8 SASI_Mm01_00098466 predicted 1232
9 SASI_Mm02_00328719 predicted 661
10 SASI_Mm01_00098467 predicted 1291
11 SASI_Mm01_00098468 predicted 376
12 SASI_Mm01_00098469 predicted 1271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025638
GDPD1 MISSION shRNA Bacterial Glycerol Stock
glycerophosphodiester phosphodiesterase domain containing 1
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025638.2-456s21c1
Sequence:CCGGTAAACGTCTCTGATCTCAAATCTCGAGATTTGAGATCAGAGACGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025638.2-1342s21c1
Sequence:CCGGCAACTGAAATGTAGATCATTGCTCGAGCAATGATCTACATTTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025638.2-887s21c1
Sequence:CCGGACTATATCCAAAGGTCATAAGCTCGAGCTTATGACCTTTGGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025638.2-217s21c1
Sequence:CCGGCTCGTTCTTGTTGCTTAAATACTCGAGTATTTAAGCAACAAGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025638.2-916s21c1
Sequence:CCGGCTGGCTTTCTGATACCTTATTCTCGAGAATAAGGTATCAGAAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025638.1-744s1c1
Sequence:CCGGCCCATTCGAGAACAGTTCTTTCTCGAGAAAGAACTGTTCTCGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025638.1-1194s1c1
Sequence:CCGGCCCTGTCTTGTGTATTTATTTCTCGAGAAATAAATACACAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025638.1-849s1c1
Sequence:CCGGGATACCTTATTGATGCGGAAACTCGAGTTTCCGCATCAATAAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025638.1-1566s1c1
Sequence:CCGGCCGTTCTGAATTATCTCGTATCTCGAGATACGAGATAATTCAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-372s1c1
Sequence:CCGGGTCAATGTAAACGTCTCTGATCTCGAGATCAGAGACGTTTACATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025638.1-1307s1c1
Sequence:CCGGGCAGCTTTCTACTATTGTAAACTCGAGTTTACAATAGTAGAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-149s1c1
Sequence:CCGGGTTGCTTAAATACCCAGCGTTCTCGAGAACGCTGGGTATTTAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-778s1c1
Sequence:CCGGCCTCCATCATACTGAAGCTAACTCGAGTTAGCTTCAGTATGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-139s1c1
Sequence:CCGGCCTCGTTCTTGTTGCTTAAATCTCGAGATTTAAGCAACAAGAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-842s1c1
Sequence:CCGGGCTTTCTGATACCTTATTGATCTCGAGATCAATAAGGTATCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-804s1c1
Sequence:CCGGCCACACACTATATCCAAAGGTCTCGAGACCTTTGGATATAGTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025638
GDPD1 MISSION shRNA shRNA Plasmid DNA
glycerophosphodiester phosphodiesterase domain containing 1
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025638.2-456s21c1
Sequence:CCGGTAAACGTCTCTGATCTCAAATCTCGAGATTTGAGATCAGAGACGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025638.2-1342s21c1
Sequence:CCGGCAACTGAAATGTAGATCATTGCTCGAGCAATGATCTACATTTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025638.2-887s21c1
Sequence:CCGGACTATATCCAAAGGTCATAAGCTCGAGCTTATGACCTTTGGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025638.2-217s21c1
Sequence:CCGGCTCGTTCTTGTTGCTTAAATACTCGAGTATTTAAGCAACAAGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025638.2-916s21c1
Sequence:CCGGCTGGCTTTCTGATACCTTATTCTCGAGAATAAGGTATCAGAAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025638.1-744s1c1
Sequence:CCGGCCCATTCGAGAACAGTTCTTTCTCGAGAAAGAACTGTTCTCGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025638.1-1194s1c1
Sequence:CCGGCCCTGTCTTGTGTATTTATTTCTCGAGAAATAAATACACAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025638.1-849s1c1
Sequence:CCGGGATACCTTATTGATGCGGAAACTCGAGTTTCCGCATCAATAAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025638.1-1566s1c1
Sequence:CCGGCCGTTCTGAATTATCTCGTATCTCGAGATACGAGATAATTCAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-372s1c1
Sequence:CCGGGTCAATGTAAACGTCTCTGATCTCGAGATCAGAGACGTTTACATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025638.1-1307s1c1
Sequence:CCGGGCAGCTTTCTACTATTGTAAACTCGAGTTTACAATAGTAGAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-149s1c1
Sequence:CCGGGTTGCTTAAATACCCAGCGTTCTCGAGAACGCTGGGTATTTAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-778s1c1
Sequence:CCGGCCTCCATCATACTGAAGCTAACTCGAGTTAGCTTCAGTATGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-139s1c1
Sequence:CCGGCCTCGTTCTTGTTGCTTAAATCTCGAGATTTAAGCAACAAGAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-842s1c1
Sequence:CCGGGCTTTCTGATACCTTATTGATCTCGAGATCAATAAGGTATCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-804s1c1
Sequence:CCGGCCACACACTATATCCAAAGGTCTCGAGACCTTTGGATATAGTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025638
GDPD1 MISSION shRNA Lentiviral Transduction Particles
glycerophosphodiester phosphodiesterase domain containing 1
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025638.2-456s21c1
Sequence:CCGGTAAACGTCTCTGATCTCAAATCTCGAGATTTGAGATCAGAGACGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025638.2-1342s21c1
Sequence:CCGGCAACTGAAATGTAGATCATTGCTCGAGCAATGATCTACATTTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025638.2-887s21c1
Sequence:CCGGACTATATCCAAAGGTCATAAGCTCGAGCTTATGACCTTTGGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025638.2-217s21c1
Sequence:CCGGCTCGTTCTTGTTGCTTAAATACTCGAGTATTTAAGCAACAAGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025638.2-916s21c1
Sequence:CCGGCTGGCTTTCTGATACCTTATTCTCGAGAATAAGGTATCAGAAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025638.1-744s1c1
Sequence:CCGGCCCATTCGAGAACAGTTCTTTCTCGAGAAAGAACTGTTCTCGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025638.1-1194s1c1
Sequence:CCGGCCCTGTCTTGTGTATTTATTTCTCGAGAAATAAATACACAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025638.1-849s1c1
Sequence:CCGGGATACCTTATTGATGCGGAAACTCGAGTTTCCGCATCAATAAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025638.1-1566s1c1
Sequence:CCGGCCGTTCTGAATTATCTCGTATCTCGAGATACGAGATAATTCAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-372s1c1
Sequence:CCGGGTCAATGTAAACGTCTCTGATCTCGAGATCAGAGACGTTTACATTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025638.1-1307s1c1
Sequence:CCGGGCAGCTTTCTACTATTGTAAACTCGAGTTTACAATAGTAGAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-149s1c1
Sequence:CCGGGTTGCTTAAATACCCAGCGTTCTCGAGAACGCTGGGTATTTAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-778s1c1
Sequence:CCGGCCTCCATCATACTGAAGCTAACTCGAGTTAGCTTCAGTATGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-139s1c1
Sequence:CCGGCCTCGTTCTTGTTGCTTAAATCTCGAGATTTAAGCAACAAGAACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-842s1c1
Sequence:CCGGGCTTTCTGATACCTTATTGATCTCGAGATCAATAAGGTATCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025638.1-804s1c1
Sequence:CCGGCCACACACTATATCCAAAGGTCTCGAGACCTTTGGATATAGTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182569
GDPD1 MISSION shRNA Bacterial Glycerol Stock
glycerophosphodiester phosphodiesterase domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182569.1-1599s1c1
Sequence:CCGGGATCATCTGAAGTCAGGAGTTCTCGAGAACTCCTGACTTCAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182569.1-231s1c1
Sequence:CCGGCCAGAGAAAGAAGCAGCGATTCTCGAGAATCGCTGCTTCTTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182569.1-642s1c1
Sequence:CCGGGCGGTATAATCGAGAACACTTCTCGAGAAGTGTTCTCGATTATACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182569.1-348s1c1
Sequence:CCGGGCTAGAATTGGACTGCCATATCTCGAGATATGGCAGTCCAATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182569.1-1483s1c1
Sequence:CCGGGCAGTGTTCTATCATAAGTAACTCGAGTTACTTATGATAGAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145458    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182569.1-1477s1c1
Sequence:CCGGGATGATGCAGTGTTCTATCATCTCGAGATGATAGAACACTGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182569.1-949s1c1
Sequence:CCGGCGAGGCATTCAAGTGTATATTCTCGAGAATATACACTTGAATGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182569.1-1438s1c1
Sequence:CCGGGAAACTAGGTTATCTGGGTTACTCGAGTAACCCAGATAACCTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182569.1-820s1c1
Sequence:CCGGGAAATCCCAATGCCTTCTATTCTCGAGAATAGAAGGCATTGGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182569
GDPD1 MISSION shRNA shRNA Plasmid DNA
glycerophosphodiester phosphodiesterase domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182569.1-1599s1c1
Sequence:CCGGGATCATCTGAAGTCAGGAGTTCTCGAGAACTCCTGACTTCAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182569.1-231s1c1
Sequence:CCGGCCAGAGAAAGAAGCAGCGATTCTCGAGAATCGCTGCTTCTTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182569.1-642s1c1
Sequence:CCGGGCGGTATAATCGAGAACACTTCTCGAGAAGTGTTCTCGATTATACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182569.1-348s1c1
Sequence:CCGGGCTAGAATTGGACTGCCATATCTCGAGATATGGCAGTCCAATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182569.1-1483s1c1
Sequence:CCGGGCAGTGTTCTATCATAAGTAACTCGAGTTACTTATGATAGAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145458    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182569.1-1477s1c1
Sequence:CCGGGATGATGCAGTGTTCTATCATCTCGAGATGATAGAACACTGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182569.1-949s1c1
Sequence:CCGGCGAGGCATTCAAGTGTATATTCTCGAGAATATACACTTGAATGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182569.1-1438s1c1
Sequence:CCGGGAAACTAGGTTATCTGGGTTACTCGAGTAACCCAGATAACCTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182569.1-820s1c1
Sequence:CCGGGAAATCCCAATGCCTTCTATTCTCGAGAATAGAAGGCATTGGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182569
GDPD1 MISSION shRNA Lentiviral Transduction Particles
glycerophosphodiester phosphodiesterase domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182569.1-1599s1c1
Sequence:CCGGGATCATCTGAAGTCAGGAGTTCTCGAGAACTCCTGACTTCAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182569.1-231s1c1
Sequence:CCGGCCAGAGAAAGAAGCAGCGATTCTCGAGAATCGCTGCTTCTTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182569.1-642s1c1
Sequence:CCGGGCGGTATAATCGAGAACACTTCTCGAGAAGTGTTCTCGATTATACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182569.1-348s1c1
Sequence:CCGGGCTAGAATTGGACTGCCATATCTCGAGATATGGCAGTCCAATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182569.1-1483s1c1
Sequence:CCGGGCAGTGTTCTATCATAAGTAACTCGAGTTACTTATGATAGAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145458    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182569.1-1477s1c1
Sequence:CCGGGATGATGCAGTGTTCTATCATCTCGAGATGATAGAACACTGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182569.1-949s1c1
Sequence:CCGGCGAGGCATTCAAGTGTATATTCTCGAGAATATACACTTGAATGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182569.1-1438s1c1
Sequence:CCGGGAAACTAGGTTATCTGGGTTACTCGAGTAACCCAGATAACCTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182569.1-820s1c1
Sequence:CCGGGAAATCCCAATGCCTTCTATTCTCGAGAATAGAAGGCATTGGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks