EMAIL THIS PAGE TO A FRIEND

GDPD2

glycerophosphodiester phosphodiesterase domain containing 2

58 Gene Product Result for
Synonyms: GDE3 OBDPF
UniProtKB ID: Q9HCC8, B4DRH4, B4DVC9, Q9NXJ6
Gene ID:
Human(54857) Summary: This gene encodes a member of the glycerophosphodiester phosphodiesterase enzyme family. The encoded protein hydrolyzes glycerophosphoinositol to produce inositol 1-phosphate and glycerol. This protein may have a role in osteoblast differentiation and growth. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Mouse(71584) glycerophosphodiester phosphodiesterase domain containing 2
Rat(302421) glycerophosphodiester phosphodiesterase domain containing 2
sheep(101101866) glycerophosphodiester phosphodiesterase domain containing 2
domestic guinea pig(100732849) glycerophosphodiester phosphodiesterase domain containing 2
naked mole-rat(101706272) glycerophosphodiester phosphodiesterase domain containing 2
chicken(422217) glycerophosphodiester phosphodiesterase domain containing 2
cow(514673) glycerophosphodiester phosphodiesterase domain containing 2
Horse(100055691) glycerophosphodiester phosphodiesterase domain containing 2
domestic cat(101088650) glycerophosphodiester phosphodiesterase domain containing 2
dog(480951) glycerophosphodiester phosphodiesterase domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017711 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023608 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023608 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023608 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017711 Rosetta Predictions human pricing
NM_001106944 Rosetta Predictions rat pricing
NM_023608 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207334 predicted 1779
2 SASI_Hs01_00207336 predicted 769
3 SASI_Hs02_00350472 predicted 1453
4 SASI_Hs01_00207338 predicted 528
5 SASI_Hs02_00350473 predicted 1709
6 SASI_Hs01_00207339 predicted 1007
7 SASI_Hs01_00207340 predicted 302
8 SASI_Hs01_00207343 predicted 519
9 SASI_Hs02_00350474 predicted 1542
10 SASI_Hs02_00350475 predicted 1841
11 SASI_Hs01_00207335 predicted 1327
12 SASI_Hs01_00207337 predicted 1554
13 SASI_Hs01_00207341 predicted 1720
14 SASI_Hs01_00207342 predicted 1838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106944 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223946 predicted 984
2 SASI_Rn02_00223947 predicted 1593
3 SASI_Rn02_00223948 predicted 1016
4 SASI_Rn02_00223949 predicted 1458
5 SASI_Rn02_00223950 predicted 1949
6 SASI_Rn02_00223951 predicted 1468
7 SASI_Rn02_00223952 predicted 1430
8 SASI_Rn02_00223953 predicted 1337
9 SASI_Rn02_00223954 predicted 1469
10 SASI_Rn02_00223955 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076252 predicted 1687
2 SASI_Mm01_00076253 predicted 1483
3 SASI_Mm01_00076254 predicted 879
4 SASI_Mm01_00076255 predicted 1562
5 SASI_Mm01_00076256 predicted 1951
6 SASI_Mm01_00076257 predicted 638
7 SASI_Mm01_00076258 predicted 563
8 SASI_Mm02_00327211 predicted 1248
9 SASI_Mm01_00076259 predicted 400
10 SASI_Mm01_00076261 predicted 851
11 SASI_Mm01_00076260 predicted 1355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017711
GDPD2 MISSION shRNA Bacterial Glycerol Stock
glycerophosphodiester phosphodiesterase domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1084s1c1
Sequence:CCGGCCACGAATGTAGCCTCTGTATCTCGAGATACAGAGGCTACATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1337s1c1
Sequence:CCGGCCACACATACTATGACACTTTCTCGAGAAAGTGTCATAGTATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1838s1c1
Sequence:CCGGGCTGACAAGGATCAACAATTTCTCGAGAAATTGTTGATCCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1686s1c2
Sequence:CCGGCGTTACCCTATCTGGCTTATTCTCGAGAATAAGCCAGATAGGGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1709s1c2
Sequence:CCGGCCCTCAAACCTACCTAATCATCTCGAGATGATTAGGTAGGTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017711.3-2001s21c1
Sequence:CCGGCACCCAAGCCAGTCTACATTGCTCGAGCAATGTAGACTGGCTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017711.3-1686s21c1
Sequence:CCGGATGTCTCGGTGAACCTATTTGCTCGAGCAAATAGGTTCACCGAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017711.3-1566s21c1
Sequence:CCGGCACCTGGAATGCGCCAGATATCTCGAGATATCTGGCGCATTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017711.3-1660s21c1
Sequence:CCGGGGATATCAAGGCATTGCATAACTCGAGTTATGCAATGCCTTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017711
GDPD2 MISSION shRNA shRNA Plasmid DNA
glycerophosphodiester phosphodiesterase domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1084s1c1
Sequence:CCGGCCACGAATGTAGCCTCTGTATCTCGAGATACAGAGGCTACATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1337s1c1
Sequence:CCGGCCACACATACTATGACACTTTCTCGAGAAAGTGTCATAGTATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1838s1c1
Sequence:CCGGGCTGACAAGGATCAACAATTTCTCGAGAAATTGTTGATCCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1686s1c2
Sequence:CCGGCGTTACCCTATCTGGCTTATTCTCGAGAATAAGCCAGATAGGGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1709s1c2
Sequence:CCGGCCCTCAAACCTACCTAATCATCTCGAGATGATTAGGTAGGTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017711.3-2001s21c1
Sequence:CCGGCACCCAAGCCAGTCTACATTGCTCGAGCAATGTAGACTGGCTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017711.3-1686s21c1
Sequence:CCGGATGTCTCGGTGAACCTATTTGCTCGAGCAAATAGGTTCACCGAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017711.3-1566s21c1
Sequence:CCGGCACCTGGAATGCGCCAGATATCTCGAGATATCTGGCGCATTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017711.3-1660s21c1
Sequence:CCGGGGATATCAAGGCATTGCATAACTCGAGTTATGCAATGCCTTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017711
GDPD2 MISSION shRNA Lentiviral Transduction Particles
glycerophosphodiester phosphodiesterase domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1084s1c1
Sequence:CCGGCCACGAATGTAGCCTCTGTATCTCGAGATACAGAGGCTACATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1337s1c1
Sequence:CCGGCCACACATACTATGACACTTTCTCGAGAAAGTGTCATAGTATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1838s1c1
Sequence:CCGGGCTGACAAGGATCAACAATTTCTCGAGAAATTGTTGATCCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1686s1c2
Sequence:CCGGCGTTACCCTATCTGGCTTATTCTCGAGAATAAGCCAGATAGGGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017711.2-1709s1c2
Sequence:CCGGCCCTCAAACCTACCTAATCATCTCGAGATGATTAGGTAGGTTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017711.3-2001s21c1
Sequence:CCGGCACCCAAGCCAGTCTACATTGCTCGAGCAATGTAGACTGGCTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017711.3-1686s21c1
Sequence:CCGGATGTCTCGGTGAACCTATTTGCTCGAGCAAATAGGTTCACCGAGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017711.3-1566s21c1
Sequence:CCGGCACCTGGAATGCGCCAGATATCTCGAGATATCTGGCGCATTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017711.3-1660s21c1
Sequence:CCGGGGATATCAAGGCATTGCATAACTCGAGTTATGCAATGCCTTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023608
GDPD2 MISSION shRNA Bacterial Glycerol Stock
glycerophosphodiester phosphodiesterase domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023608.2-2351s1c1
Sequence:CCGGCCCTCACACTTCATCTTCTTTCTCGAGAAAGAAGATGAAGTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023608.2-1594s1c1
Sequence:CCGGCCAGGATAATATCTCAGTGAACTCGAGTTCACTGAGATATTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023608.2-337s1c1
Sequence:CCGGCCACTGGAGGAAATATCCTAACTCGAGTTAGGATATTTCCTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023608.2-1324s1c1
Sequence:CCGGCCTTTCCATCATGTTTGACTTCTCGAGAAGTCAAACATGATGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023608.2-915s1c1
Sequence:CCGGGCATCATGAAACTCAGAGATTCTCGAGAATCTCTGAGTTTCATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023608
GDPD2 MISSION shRNA shRNA Plasmid DNA
glycerophosphodiester phosphodiesterase domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023608.2-2351s1c1
Sequence:CCGGCCCTCACACTTCATCTTCTTTCTCGAGAAAGAAGATGAAGTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023608.2-1594s1c1
Sequence:CCGGCCAGGATAATATCTCAGTGAACTCGAGTTCACTGAGATATTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023608.2-337s1c1
Sequence:CCGGCCACTGGAGGAAATATCCTAACTCGAGTTAGGATATTTCCTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023608.2-1324s1c1
Sequence:CCGGCCTTTCCATCATGTTTGACTTCTCGAGAAGTCAAACATGATGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023608.2-915s1c1
Sequence:CCGGGCATCATGAAACTCAGAGATTCTCGAGAATCTCTGAGTTTCATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023608
GDPD2 MISSION shRNA Lentiviral Transduction Particles
glycerophosphodiester phosphodiesterase domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023608.2-2351s1c1
Sequence:CCGGCCCTCACACTTCATCTTCTTTCTCGAGAAAGAAGATGAAGTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023608.2-1594s1c1
Sequence:CCGGCCAGGATAATATCTCAGTGAACTCGAGTTCACTGAGATATTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023608.2-337s1c1
Sequence:CCGGCCACTGGAGGAAATATCCTAACTCGAGTTAGGATATTTCCTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023608.2-1324s1c1
Sequence:CCGGCCTTTCCATCATGTTTGACTTCTCGAGAAGTCAAACATGATGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023608.2-915s1c1
Sequence:CCGGGCATCATGAAACTCAGAGATTCTCGAGAATCTCTGAGTTTCATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks