EMAIL THIS PAGE TO A FRIEND

GDPD3

glycerophosphodiester phosphodiesterase domain containing 3

68 Gene Product Result for
UniProtKB ID: Q7L5L3, Q9H652
Gene ID:
Mouse(68616) glycerophosphodiester phosphodiesterase domain containing 3
Rat(293490) glycerophosphodiester phosphodiesterase domain containing 3
domestic cat(101080853) glycerophosphodiester phosphodiesterase domain containing 3
cow(767913) glycerophosphodiester phosphodiesterase domain containing 3
dog(479789) glycerophosphodiester phosphodiesterase domain containing 3
naked mole-rat(101698285) glycerophosphodiester phosphodiesterase domain containing 3
domestic guinea pig(100725963) glycerophosphodiester phosphodiesterase domain containing 3
sheep(101114996) glycerophosphodiester phosphodiesterase domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024228 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024228 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024228 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024307 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064161 MISSION® esiRNA esiRNA human GDPD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031718 Rosetta Predictions human pricing
NM_024307 Rosetta Predictions human pricing
XM_215061 Rosetta Predictions rat pricing
XR_009334 Rosetta Predictions rat pricing
NM_024228 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096204 predicted 511
2 SASI_Hs01_00096205 predicted 583
3 SASI_Hs01_00096206 predicted 562
4 SASI_Hs01_00096207 predicted 824
5 SASI_Hs01_00096208 predicted 571
6 SASI_Hs01_00096209 predicted 493
7 SASI_Hs01_00096210 predicted 528
8 SASI_Hs01_00096211 predicted 785
9 SASI_Hs01_00096212 predicted 612
10 SASI_Hs01_00096213 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100053 predicted 575
2 SASI_Hs01_00100054 predicted 557
3 SASI_Hs02_00356647 predicted 507
4 SASI_Hs02_00356648 predicted 570
5 SASI_Hs01_00100055 predicted 810
6 SASI_Hs01_00100056 predicted 569
7 SASI_Hs01_00100058 predicted 520
8 SASI_Hs01_00100059 predicted 777
9 SASI_Hs02_00356649 predicted 510
10 SASI_Hs01_00100060 predicted 608
11 SASI_Hs01_00100052 predicted 718
12 SASI_Hs01_00100057 predicted 700
13 SASI_Hs01_00100061 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165955 predicted 222
2 SASI_Rn01_00165956 predicted 255
3 SASI_Rn01_00165957 predicted 262
4 SASI_Rn01_00165958 predicted 257
5 SASI_Rn01_00165959 predicted 225
6 SASI_Rn01_00165960 predicted 299
7 SASI_Rn01_00165961 predicted 246
8 SASI_Rn01_00165962 predicted 251
9 SASI_Rn01_00165963 predicted 220
10 SASI_Rn01_00165964 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160853 predicted 211
2 SASI_Rn01_00160854 predicted 254
3 SASI_Rn02_00419415 predicted 280
4 SASI_Rn01_00160857 predicted 213
5 SASI_Rn01_00160858 predicted 300
6 SASI_Rn01_00160859 predicted 245
7 SASI_Rn02_00419416 predicted 295
8 SASI_Rn01_00160860 predicted 242
9 SASI_Rn01_00160861 predicted 212
10 SASI_Rn01_00160862 predicted 279
11 SASI_Rn01_00160855 predicted 254
12 SASI_Rn01_00160856 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037922 predicted 552
2 SASI_Mm01_00037923 predicted 337
3 SASI_Mm01_00037924 predicted 791
4 SASI_Mm01_00037926 predicted 751
5 SASI_Mm01_00037927 predicted 515
6 SASI_Mm01_00037928 predicted 768
7 SASI_Mm01_00037929 predicted 536
8 SASI_Mm01_00037930 predicted 489
9 SASI_Mm01_00037931 predicted 395
10 SASI_Mm02_00327598 predicted 444
11 SASI_Mm01_00037925 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024228
GDPD3 MISSION shRNA Bacterial Glycerol Stock
glycerophosphodiester phosphodiesterase domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-809s1c1
Sequence:CCGGGCCTTAATGAAGAATCGGATTCTCGAGAATCCGATTCTTCATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-484s1c1
Sequence:CCGGGACCGGAATGAGATTACTATTCTCGAGAATAGTAATCTCATTCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-366s1c1
Sequence:CCGGGCACATGATTAGTTTGGAGGACTCGAGTCCTCCAAACTAATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-678s1c1
Sequence:CCGGCAACAGGACTTACTTCCCATTCTCGAGAATGGGAAGTAAGTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-669s1c1
Sequence:CCGGCACCATCATCAACAGGACTTACTCGAGTAAGTCCTGTTGATGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024228
GDPD3 MISSION shRNA shRNA Plasmid DNA
glycerophosphodiester phosphodiesterase domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-809s1c1
Sequence:CCGGGCCTTAATGAAGAATCGGATTCTCGAGAATCCGATTCTTCATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-484s1c1
Sequence:CCGGGACCGGAATGAGATTACTATTCTCGAGAATAGTAATCTCATTCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-366s1c1
Sequence:CCGGGCACATGATTAGTTTGGAGGACTCGAGTCCTCCAAACTAATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-678s1c1
Sequence:CCGGCAACAGGACTTACTTCCCATTCTCGAGAATGGGAAGTAAGTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-669s1c1
Sequence:CCGGCACCATCATCAACAGGACTTACTCGAGTAAGTCCTGTTGATGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024228
GDPD3 MISSION shRNA Lentiviral Transduction Particles
glycerophosphodiester phosphodiesterase domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-809s1c1
Sequence:CCGGGCCTTAATGAAGAATCGGATTCTCGAGAATCCGATTCTTCATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-484s1c1
Sequence:CCGGGACCGGAATGAGATTACTATTCTCGAGAATAGTAATCTCATTCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-366s1c1
Sequence:CCGGGCACATGATTAGTTTGGAGGACTCGAGTCCTCCAAACTAATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-678s1c1
Sequence:CCGGCAACAGGACTTACTTCCCATTCTCGAGAATGGGAAGTAAGTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024228.1-669s1c1
Sequence:CCGGCACCATCATCAACAGGACTTACTCGAGTAAGTCCTGTTGATGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024307
GDPD3 MISSION shRNA Bacterial Glycerol Stock
glycerophosphodiester phosphodiesterase domain containing 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-880s1c1
Sequence:CCGGCCTTCACAATAAGCCGAGGATCTCGAGATCCTCGGCTTATTGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165188    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024307.1-1171s1c1
Sequence:CCGGGCGTCATAACGGATTATCCCACTCGAGTGGGATAATCCGTTATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-938s1c1
Sequence:CCGGCTTCATCCCAATCCCTGAGAACTCGAGTTCTCAGGGATTGGGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161532    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024307.1-1120s1c1
Sequence:CCGGGCCTTAATGAAGAGTCGGATTCTCGAGAATCCGACTCTTCATTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-735s1c1
Sequence:CCGGGAGATCAAAGGGAAGAACGAACTCGAGTTCGTTCTTCCCTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-787s1c1
Sequence:CCGGGACGCTATGACCGTAATGAAACTCGAGTTTCATTACGGTCATAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-731s1c1
Sequence:CCGGCGTAGAGATCAAAGGGAAGAACTCGAGTTCTTCCCTTTGATCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-833s1c1
Sequence:CCGGCTCGGTCATGAAGAAATGCAACTCGAGTTGCATTTCTTCATGACCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-842s1c1
Sequence:CCGGGAAGAAATGCAAGGCTGCCAACTCGAGTTGGCAGCCTTGCATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-753s1c1
Sequence:CCGGGAAGAGCTCATCCGTGAGATACTCGAGTATCTCACGGATGAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024307
GDPD3 MISSION shRNA shRNA Plasmid DNA
glycerophosphodiester phosphodiesterase domain containing 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-880s1c1
Sequence:CCGGCCTTCACAATAAGCCGAGGATCTCGAGATCCTCGGCTTATTGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165188    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024307.1-1171s1c1
Sequence:CCGGGCGTCATAACGGATTATCCCACTCGAGTGGGATAATCCGTTATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-938s1c1
Sequence:CCGGCTTCATCCCAATCCCTGAGAACTCGAGTTCTCAGGGATTGGGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161532    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024307.1-1120s1c1
Sequence:CCGGGCCTTAATGAAGAGTCGGATTCTCGAGAATCCGACTCTTCATTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-735s1c1
Sequence:CCGGGAGATCAAAGGGAAGAACGAACTCGAGTTCGTTCTTCCCTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-787s1c1
Sequence:CCGGGACGCTATGACCGTAATGAAACTCGAGTTTCATTACGGTCATAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-731s1c1
Sequence:CCGGCGTAGAGATCAAAGGGAAGAACTCGAGTTCTTCCCTTTGATCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-833s1c1
Sequence:CCGGCTCGGTCATGAAGAAATGCAACTCGAGTTGCATTTCTTCATGACCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-842s1c1
Sequence:CCGGGAAGAAATGCAAGGCTGCCAACTCGAGTTGGCAGCCTTGCATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-753s1c1
Sequence:CCGGGAAGAGCTCATCCGTGAGATACTCGAGTATCTCACGGATGAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024307
GDPD3 MISSION shRNA Lentiviral Transduction Particles
glycerophosphodiester phosphodiesterase domain containing 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-880s1c1
Sequence:CCGGCCTTCACAATAAGCCGAGGATCTCGAGATCCTCGGCTTATTGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165188    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024307.1-1171s1c1
Sequence:CCGGGCGTCATAACGGATTATCCCACTCGAGTGGGATAATCCGTTATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-938s1c1
Sequence:CCGGCTTCATCCCAATCCCTGAGAACTCGAGTTCTCAGGGATTGGGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161532    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024307.1-1120s1c1
Sequence:CCGGGCCTTAATGAAGAGTCGGATTCTCGAGAATCCGACTCTTCATTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-735s1c1
Sequence:CCGGGAGATCAAAGGGAAGAACGAACTCGAGTTCGTTCTTCCCTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-787s1c1
Sequence:CCGGGACGCTATGACCGTAATGAAACTCGAGTTTCATTACGGTCATAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-731s1c1
Sequence:CCGGCGTAGAGATCAAAGGGAAGAACTCGAGTTCTTCCCTTTGATCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-833s1c1
Sequence:CCGGCTCGGTCATGAAGAAATGCAACTCGAGTTGCATTTCTTCATGACCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-842s1c1
Sequence:CCGGGAAGAAATGCAAGGCTGCCAACTCGAGTTGGCAGCCTTGCATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024307.1-753s1c1
Sequence:CCGGGAAGAGCTCATCCGTGAGATACTCGAGTATCTCACGGATGAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks