EMAIL THIS PAGE TO A FRIEND

GDPD4

glycerophosphodiester phosphodiesterase domain containing 4

55 Gene Product Result for
Synonyms: GDE6
UniProtKB ID: Q6W3E5, Q7Z5B0
Gene ID:
Mouse(233537) glycerophosphodiester phosphodiesterase domain containing 4
Rat(680990) glycerophosphodiester phosphodiesterase domain containing 4
chicken(419084) glycerophosphodiester phosphodiesterase domain containing 4
domestic cat(101089138) glycerophosphodiester phosphodiesterase domain containing 4
dog(485173) glycerophosphodiester phosphodiesterase domain containing 4
cow(784501) glycerophosphodiester phosphodiesterase domain containing 4
domestic guinea pig(100733499) glycerophosphodiester phosphodiesterase domain containing 4
naked mole-rat(101712373) glycerophosphodiester phosphodiesterase domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182833 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121761 MISSION® esiRNA esiRNA human GDPD4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182833 Rosetta Predictions human pricing
XM_001059822 Rosetta Predictions rat pricing
NM_177696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235356 predicted 583
2 SASI_Hs01_00235357 predicted 444
3 SASI_Hs01_00235358 predicted 619
4 SASI_Hs02_00370971 predicted 768
5 SASI_Hs01_00235359 predicted 1525
6 SASI_Hs01_00235361 predicted 688
7 SASI_Hs01_00235362 predicted 924
8 SASI_Hs02_00370972 predicted 1468
9 SASI_Hs02_00370973 predicted 1272
10 SASI_Hs01_00235363 predicted 849
11 SASI_Hs01_00235360 predicted 744
12 SASI_Hs01_00235364 predicted 701
13 SASI_Hs01_00235365 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059822 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294459 predicted 653
2 SASI_Rn02_00294460 predicted 1446
3 SASI_Rn02_00294461 predicted 206
4 SASI_Rn02_00294462 predicted 1079
5 SASI_Rn02_00294463 predicted 251
6 SASI_Rn02_00294464 predicted 1013
7 SASI_Rn02_00294465 predicted 354
8 SASI_Rn02_00294466 predicted 1045
9 SASI_Rn02_00294467 predicted 638
10 SASI_Rn02_00294468 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025400 predicted 768
2 SASI_Mm01_00025401 predicted 1016
3 SASI_Mm01_00025402 predicted 1173
4 SASI_Mm01_00025404 predicted 1857
5 SASI_Mm02_00348040 predicted 924
6 SASI_Mm01_00025405 predicted 1845
7 SASI_Mm01_00025406 predicted 1553
8 SASI_Mm01_00025407 predicted 606
9 SASI_Mm01_00025408 predicted 1432
10 SASI_Mm01_00025409 predicted 1145
11 SASI_Mm01_00025403 predicted 353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182833
GDPD4 MISSION shRNA Bacterial Glycerol Stock
glycerophosphodiester phosphodiesterase domain containing 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182833.1-741s1c1
Sequence:CCGGCCTGTTGGATTACCCTTTCTTCTCGAGAAGAAAGGGTAATCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182833.1-2065s1c1
Sequence:CCGGGCTACAAGTGAGGCTACCTTTCTCGAGAAAGGTAGCCTCACTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182833.1-379s1c1
Sequence:CCGGCCTACTCTTCATTGCTGTTGTCTCGAGACAACAGCAATGAAGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182833.1-2249s1c1
Sequence:CCGGCCAAAGAAGAATTAGCCACATCTCGAGATGTGGCTAATTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182833.1-1771s1c1
Sequence:CCGGGCACAGATACTCAGAGTGGAACTCGAGTTCCACTCTGAGTATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182833.1-707s21c1
Sequence:CCGGTAATGTAATCACAAGGTTAAGCTCGAGCTTAACCTTGTGATTACATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182833.1-1519s21c1
Sequence:CCGGTCAACGTATACACCGTCAATGCTCGAGCATTGACGGTGTATACGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182833.1-1471s21c1
Sequence:CCGGAGTTGTTCCCTAATGGGTTAACTCGAGTTAACCCATTAGGGAACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182833.1-1392s21c1
Sequence:CCGGTTTCAGCATGTGGGCCGTTTACTCGAGTAAACGGCCCACATGCTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182833
GDPD4 MISSION shRNA shRNA Plasmid DNA
glycerophosphodiester phosphodiesterase domain containing 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182833.1-741s1c1
Sequence:CCGGCCTGTTGGATTACCCTTTCTTCTCGAGAAGAAAGGGTAATCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182833.1-2065s1c1
Sequence:CCGGGCTACAAGTGAGGCTACCTTTCTCGAGAAAGGTAGCCTCACTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182833.1-379s1c1
Sequence:CCGGCCTACTCTTCATTGCTGTTGTCTCGAGACAACAGCAATGAAGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182833.1-2249s1c1
Sequence:CCGGCCAAAGAAGAATTAGCCACATCTCGAGATGTGGCTAATTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182833.1-1771s1c1
Sequence:CCGGGCACAGATACTCAGAGTGGAACTCGAGTTCCACTCTGAGTATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182833.1-707s21c1
Sequence:CCGGTAATGTAATCACAAGGTTAAGCTCGAGCTTAACCTTGTGATTACATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182833.1-1519s21c1
Sequence:CCGGTCAACGTATACACCGTCAATGCTCGAGCATTGACGGTGTATACGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182833.1-1471s21c1
Sequence:CCGGAGTTGTTCCCTAATGGGTTAACTCGAGTTAACCCATTAGGGAACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182833.1-1392s21c1
Sequence:CCGGTTTCAGCATGTGGGCCGTTTACTCGAGTAAACGGCCCACATGCTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182833
GDPD4 MISSION shRNA Lentiviral Transduction Particles
glycerophosphodiester phosphodiesterase domain containing 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182833.1-741s1c1
Sequence:CCGGCCTGTTGGATTACCCTTTCTTCTCGAGAAGAAAGGGTAATCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182833.1-2065s1c1
Sequence:CCGGGCTACAAGTGAGGCTACCTTTCTCGAGAAAGGTAGCCTCACTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182833.1-379s1c1
Sequence:CCGGCCTACTCTTCATTGCTGTTGTCTCGAGACAACAGCAATGAAGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182833.1-2249s1c1
Sequence:CCGGCCAAAGAAGAATTAGCCACATCTCGAGATGTGGCTAATTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182833.1-1771s1c1
Sequence:CCGGGCACAGATACTCAGAGTGGAACTCGAGTTCCACTCTGAGTATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182833.1-707s21c1
Sequence:CCGGTAATGTAATCACAAGGTTAAGCTCGAGCTTAACCTTGTGATTACATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182833.1-1519s21c1
Sequence:CCGGTCAACGTATACACCGTCAATGCTCGAGCATTGACGGTGTATACGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182833.1-1471s21c1
Sequence:CCGGAGTTGTTCCCTAATGGGTTAACTCGAGTTAACCCATTAGGGAACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182833.1-1392s21c1
Sequence:CCGGTTTCAGCATGTGGGCCGTTTACTCGAGTAAACGGCCCACATGCTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177696
GDPD4 MISSION shRNA Bacterial Glycerol Stock
glycerophosphodiester phosphodiesterase domain containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177696.2-1081s1c1
Sequence:CCGGCCTGACTAGAACAACTAACATCTCGAGATGTTAGTTGTTCTAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177696.2-1084s1c1
Sequence:CCGGGACTAGAACAACTAACATCAACTCGAGTTGATGTTAGTTGTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177696.2-1549s1c1
Sequence:CCGGGAGATTGTTCTACGCTGGGTTCTCGAGAACCCAGCGTAGAACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177696.2-2031s1c1
Sequence:CCGGGAGATATTGAAACTCTCCATTCTCGAGAATGGAGAGTTTCAATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177696.2-2160s1c1
Sequence:CCGGCAAGGGAGTTATTAGTGTCATCTCGAGATGACACTAATAACTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177696
GDPD4 MISSION shRNA shRNA Plasmid DNA
glycerophosphodiester phosphodiesterase domain containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177696.2-1081s1c1
Sequence:CCGGCCTGACTAGAACAACTAACATCTCGAGATGTTAGTTGTTCTAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177696.2-1084s1c1
Sequence:CCGGGACTAGAACAACTAACATCAACTCGAGTTGATGTTAGTTGTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177696.2-1549s1c1
Sequence:CCGGGAGATTGTTCTACGCTGGGTTCTCGAGAACCCAGCGTAGAACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177696.2-2031s1c1
Sequence:CCGGGAGATATTGAAACTCTCCATTCTCGAGAATGGAGAGTTTCAATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177696.2-2160s1c1
Sequence:CCGGCAAGGGAGTTATTAGTGTCATCTCGAGATGACACTAATAACTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177696
GDPD4 MISSION shRNA Lentiviral Transduction Particles
glycerophosphodiester phosphodiesterase domain containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177696.2-1081s1c1
Sequence:CCGGCCTGACTAGAACAACTAACATCTCGAGATGTTAGTTGTTCTAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177696.2-1084s1c1
Sequence:CCGGGACTAGAACAACTAACATCAACTCGAGTTGATGTTAGTTGTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177696.2-1549s1c1
Sequence:CCGGGAGATTGTTCTACGCTGGGTTCTCGAGAACCCAGCGTAGAACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177696.2-2031s1c1
Sequence:CCGGGAGATATTGAAACTCTCCATTCTCGAGAATGGAGAGTTTCAATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177696.2-2160s1c1
Sequence:CCGGCAAGGGAGTTATTAGTGTCATCTCGAGATGACACTAATAACTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks