EMAIL THIS PAGE TO A FRIEND

GDPD5

glycerophosphodiester phosphodiesterase domain containing 5

72 Gene Product Result for
Synonyms: GDE2 PP1665
Gene ID:
Human(81544) Summary: Glycerophosphodiester phosphodiesterases (GDPDs; EC 3.1.4.46), such as GDPD5, are involved in glycerol metabolism (Lang et al., 2008 [PubMed 17578682]
Mouse(233552) glycerophosphodiester phosphodiesterase domain containing 5
Rat(499211) glycerophosphodiester phosphodiesterase domain containing 5
chicken(419070) glycerophosphodiester phosphodiesterase domain containing 5
dog(485188) glycerophosphodiester phosphodiesterase domain containing 5
Horse(100064592) glycerophosphodiester phosphodiesterase domain containing 5
cow(532719) glycerophosphodiester phosphodiesterase domain containing 5
domestic cat(101091650) glycerophosphodiester phosphodiesterase domain containing 5
naked mole-rat(101701090) glycerophosphodiester phosphodiesterase domain containing 5
domestic guinea pig(100728386) glycerophosphodiester phosphodiesterase domain containing 5
sheep(101108948) glycerophosphodiester phosphodiesterase domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030792 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030792 Rosetta Predictions human pricing
NM_001109152 Rosetta Predictions rat pricing
NM_201352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202147 predicted 2969
2 SASI_Hs01_00202148 predicted 2332
3 SASI_Hs01_00202149 predicted 1487
4 SASI_Hs01_00202150 predicted 845
5 SASI_Hs01_00202151 predicted 1276
6 SASI_Hs02_00358344 predicted 2965
7 SASI_Hs01_00202152 predicted 2459
8 SASI_Hs01_00202153 predicted 3040
9 SASI_Hs01_00202155 predicted 2474
10 SASI_Hs01_00202156 predicted 2098
11 SASI_Hs01_00202154 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245640 predicted 2617
2 SASI_Rn02_00245641 predicted 2512
3 SASI_Rn02_00245642 predicted 3340
4 SASI_Rn02_00245643 predicted 3485
5 SASI_Rn02_00245644 predicted 3087
6 SASI_Rn02_00245645 predicted 2964
7 SASI_Rn02_00245646 predicted 3145
8 SASI_Rn02_00245647 predicted 3035
9 SASI_Rn02_00245648 predicted 2571
10 SASI_Rn02_00245649 predicted 2663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351506 predicted 2425
2 SASI_Mm01_00169279 predicted 2054
3 SASI_Mm01_00169280 predicted 1497
4 SASI_Mm01_00169281 predicted 2139
5 SASI_Mm01_00169282 predicted 2609
6 SASI_Mm01_00169283 predicted 1616
7 SASI_Mm01_00169284 predicted 2589
8 SASI_Mm01_00169285 predicted 2119
9 SASI_Mm01_00169286 predicted 1094
10 SASI_Mm01_00169287 predicted 2698
11 SASI_Mm01_00169288 predicted 2117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030792
GDPD5 MISSION shRNA Bacterial Glycerol Stock
glycerophosphodiester phosphodiesterase domain containing 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030792.6-671s21c1
Sequence:CCGGTCTGGTGGGAAGTCCACAATGCTCGAGCATTGTGGACTTCCCACCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030792.6-806s21c1
Sequence:CCGGTCCTGGCACTATGTCACATTGCTCGAGCAATGTGACATAGTGCCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030792.6-2197s21c1
Sequence:CCGGGTATGTTCAGACAACAGTTATCTCGAGATAACTGTTGTCTGAACATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030792.6-771s21c1
Sequence:CCGGAGCTGCTGCCTTCGCATACATCTCGAGATGTATGCGAAGGCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030792.6-3068s21c1
Sequence:CCGGCCTGGTAGAAGTGTTCTGGATCTCGAGATCCAGAACACTTCTACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030792.4-3337s1c1
Sequence:CCGGCCTGGTAGAAGTGTTCTGGATCTCGAGATCCAGAACACTTCTACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030792.4-953s1c1
Sequence:CCGGCCACAATGACTATGATGAATTCTCGAGAATTCATCATAGTCATTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030792.4-2475s1c1
Sequence:CCGGGACAACAGTTATGACACATATCTCGAGATATGTGTCATAACTGTTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030792.4-2459s1c1
Sequence:CCGGGCTCTCCGTATGTTCAGACAACTCGAGTTGTCTGAACATACGGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030792.4-1074s1c1
Sequence:CCGGGTCCTGGCACTATGTCACATTCTCGAGAATGTGACATAGTGCCAGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030792
GDPD5 MISSION shRNA shRNA Plasmid DNA
glycerophosphodiester phosphodiesterase domain containing 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030792.6-671s21c1
Sequence:CCGGTCTGGTGGGAAGTCCACAATGCTCGAGCATTGTGGACTTCCCACCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030792.6-806s21c1
Sequence:CCGGTCCTGGCACTATGTCACATTGCTCGAGCAATGTGACATAGTGCCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030792.6-2197s21c1
Sequence:CCGGGTATGTTCAGACAACAGTTATCTCGAGATAACTGTTGTCTGAACATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030792.6-771s21c1
Sequence:CCGGAGCTGCTGCCTTCGCATACATCTCGAGATGTATGCGAAGGCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030792.6-3068s21c1
Sequence:CCGGCCTGGTAGAAGTGTTCTGGATCTCGAGATCCAGAACACTTCTACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030792.4-3337s1c1
Sequence:CCGGCCTGGTAGAAGTGTTCTGGATCTCGAGATCCAGAACACTTCTACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030792.4-953s1c1
Sequence:CCGGCCACAATGACTATGATGAATTCTCGAGAATTCATCATAGTCATTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030792.4-2475s1c1
Sequence:CCGGGACAACAGTTATGACACATATCTCGAGATATGTGTCATAACTGTTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030792.4-2459s1c1
Sequence:CCGGGCTCTCCGTATGTTCAGACAACTCGAGTTGTCTGAACATACGGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030792.4-1074s1c1
Sequence:CCGGGTCCTGGCACTATGTCACATTCTCGAGAATGTGACATAGTGCCAGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030792
GDPD5 MISSION shRNA Lentiviral Transduction Particles
glycerophosphodiester phosphodiesterase domain containing 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030792.6-671s21c1
Sequence:CCGGTCTGGTGGGAAGTCCACAATGCTCGAGCATTGTGGACTTCCCACCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030792.6-806s21c1
Sequence:CCGGTCCTGGCACTATGTCACATTGCTCGAGCAATGTGACATAGTGCCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030792.6-2197s21c1
Sequence:CCGGGTATGTTCAGACAACAGTTATCTCGAGATAACTGTTGTCTGAACATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030792.6-771s21c1
Sequence:CCGGAGCTGCTGCCTTCGCATACATCTCGAGATGTATGCGAAGGCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030792.6-3068s21c1
Sequence:CCGGCCTGGTAGAAGTGTTCTGGATCTCGAGATCCAGAACACTTCTACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030792.4-3337s1c1
Sequence:CCGGCCTGGTAGAAGTGTTCTGGATCTCGAGATCCAGAACACTTCTACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030792.4-953s1c1
Sequence:CCGGCCACAATGACTATGATGAATTCTCGAGAATTCATCATAGTCATTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030792.4-2475s1c1
Sequence:CCGGGACAACAGTTATGACACATATCTCGAGATATGTGTCATAACTGTTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030792.4-2459s1c1
Sequence:CCGGGCTCTCCGTATGTTCAGACAACTCGAGTTGTCTGAACATACGGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030792.4-1074s1c1
Sequence:CCGGGTCCTGGCACTATGTCACATTCTCGAGAATGTGACATAGTGCCAGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201352
VALIDATED
GDPD5 MISSION shRNA Bacterial Glycerol Stock
glycerophosphodiester phosphodiesterase domain containing 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201352.2-2052s1c1
Sequence:CCGGCCAGGTCATGTGGCTATTTAACTCGAGTTAAATAGCCACATGACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201352.2-2612s1c1
Sequence:CCGGGTTACGACACCTATGCTAATGCTCGAGCATTAGCATAGGTGTCGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201352.2-2611s21c1
Sequence:CCGGAGTTACGACACCTATGCTAATCTCGAGATTAGCATAGGTGTCGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201352.2-3090s21c1
Sequence:CCGGATGCCCACACCTCTCTATTTACTCGAGTAAATAGAGAGGTGTGGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201352.2-2452s21c1
Sequence:CCGGCTGGGTGGTATACGGAGTTACCTCGAGGTAACTCCGTATACCACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201352.2-2051s21c1
Sequence:CCGGACCAGGTCATGTGGCTATTTACTCGAGTAAATAGCCACATGACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201352.2-1366s21c1
Sequence:CCGGACGGCACCATTCCTGCATATACTCGAGTATATGCAGGAATGGTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201352.2-2137s1c1
Sequence:CCGGGCCATCGCTAACTTACGGAAACTCGAGTTTCCGTAAGTTAGCGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201352
VALIDATED
GDPD5 MISSION shRNA shRNA Plasmid DNA
glycerophosphodiester phosphodiesterase domain containing 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201352.2-2052s1c1
Sequence:CCGGCCAGGTCATGTGGCTATTTAACTCGAGTTAAATAGCCACATGACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201352.2-2612s1c1
Sequence:CCGGGTTACGACACCTATGCTAATGCTCGAGCATTAGCATAGGTGTCGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201352.2-2611s21c1
Sequence:CCGGAGTTACGACACCTATGCTAATCTCGAGATTAGCATAGGTGTCGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201352.2-3090s21c1
Sequence:CCGGATGCCCACACCTCTCTATTTACTCGAGTAAATAGAGAGGTGTGGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201352.2-2452s21c1
Sequence:CCGGCTGGGTGGTATACGGAGTTACCTCGAGGTAACTCCGTATACCACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201352.2-2051s21c1
Sequence:CCGGACCAGGTCATGTGGCTATTTACTCGAGTAAATAGCCACATGACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201352.2-1366s21c1
Sequence:CCGGACGGCACCATTCCTGCATATACTCGAGTATATGCAGGAATGGTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201352.2-2137s1c1
Sequence:CCGGGCCATCGCTAACTTACGGAAACTCGAGTTTCCGTAAGTTAGCGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201352
VALIDATED
GDPD5 MISSION shRNA Lentiviral Transduction Particles
glycerophosphodiester phosphodiesterase domain containing 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201352.2-2052s1c1
Sequence:CCGGCCAGGTCATGTGGCTATTTAACTCGAGTTAAATAGCCACATGACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201352.2-2612s1c1
Sequence:CCGGGTTACGACACCTATGCTAATGCTCGAGCATTAGCATAGGTGTCGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201352.2-2611s21c1
Sequence:CCGGAGTTACGACACCTATGCTAATCTCGAGATTAGCATAGGTGTCGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201352.2-3090s21c1
Sequence:CCGGATGCCCACACCTCTCTATTTACTCGAGTAAATAGAGAGGTGTGGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201352.2-2452s21c1
Sequence:CCGGCTGGGTGGTATACGGAGTTACCTCGAGGTAACTCCGTATACCACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201352.2-2051s21c1
Sequence:CCGGACCAGGTCATGTGGCTATTTACTCGAGTAAATAGCCACATGACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201352.2-1366s21c1
Sequence:CCGGACGGCACCATTCCTGCATATACTCGAGTATATGCAGGAATGGTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201352.2-2137s1c1
Sequence:CCGGGCCATCGCTAACTTACGGAAACTCGAGTTTCCGTAAGTTAGCGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)