EMAIL THIS PAGE TO A FRIEND

GDPGP1

GDP-D-glucose phosphorylase 1

53 Gene Product Result for
Synonyms: C15orf58 VTC2
UniProtKB ID: Q6ZNW5
Gene ID:
Mouse(269952) GDP-D-glucose phosphorylase 1
Rat(308763) GDP-D-glucose phosphorylase 1
cow(522909) GDP-D-glucose phosphorylase 1
domestic cat(101082062) GDP-D-glucose phosphorylase 1
dog(479045) GDP-D-glucose phosphorylase 1
sheep(101105361) GDP-D-glucose phosphorylase 1
domestic guinea pig(100728638) GDP-D-glucose phosphorylase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001013657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013657 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101171 MISSION® esiRNA esiRNA human C15orf58 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013657 Rosetta Predictions human pricing
XM_001066043 Rosetta Predictions rat pricing
XM_218822 Rosetta Predictions rat pricing
NM_178752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306426 predicted 272
2 SASI_Hs01_00063184 predicted 332
3 SASI_Hs02_00306427 predicted 249
4 SASI_Hs01_00063185 predicted 319
5 SASI_Hs01_00063187 predicted 565
6 SASI_Hs01_00063188 predicted 1124
7 SASI_Hs01_00063189 predicted 990
8 SASI_Hs01_00063190 predicted 983
9 SASI_Hs01_00063191 predicted 997
10 SASI_Hs01_00063192 predicted 568
11 SASI_Hs01_00063183 predicted 1101
12 SASI_Hs01_00063186 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316156 predicted 788
2 SASI_Rn02_00316157 predicted 951
3 SASI_Rn02_00316158 predicted 925
4 SASI_Rn02_00316159 predicted 845
5 SASI_Rn02_00316160 predicted 827
6 SASI_Rn02_00316161 predicted 404
7 SASI_Rn02_00316162 predicted 811
8 SASI_Rn02_00316163 predicted 344
9 SASI_Rn02_00316164 predicted 821
10 SASI_Rn02_00316165 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218822 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378092 predicted 780
2 SASI_Rn02_00378093 predicted 951
3 SASI_Rn02_00378094 predicted 927
4 SASI_Rn02_00378095 predicted 846
5 SASI_Rn02_00378096 predicted 829
6 SASI_Rn02_00378097 predicted 405
7 SASI_Rn02_00378098 predicted 813
8 SASI_Rn02_00378099 predicted 344
9 SASI_Rn02_00378100 predicted 825
10 SASI_Rn02_00378101 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349286 predicted 1295
2 SASI_Mm02_00349287 predicted 1252
3 SASI_Mm02_00349288 predicted 483
4 SASI_Mm02_00349289 predicted 1115
5 SASI_Mm02_00349290 predicted 1165
6 SASI_Mm02_00349291 predicted 1529
7 SASI_Mm02_00349292 predicted 1546
8 SASI_Mm02_00349293 predicted 1113
9 SASI_Mm02_00349294 predicted 1169
10 SASI_Mm02_00349295 predicted 1119
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178752
GDPGP1 MISSION shRNA Bacterial Glycerol Stock
GDP-D-glucose phosphorylase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178752.2-2975s1c1
Sequence:CCGGGCTACCATCAAACTCCTCAAACTCGAGTTTGAGGAGTTTGATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178752.2-3926s1c1
Sequence:CCGGGCTCATCAGTTAAGATTGATTCTCGAGAATCAATCTTAACTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178752.2-737s1c1
Sequence:CCGGCGGATGCAAAGGGAACCTAAACTCGAGTTTAGGTTCCCTTTGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178752.3-780s21c1
Sequence:CCGGACGTCCTTGTGGTGATCAATGCTCGAGCATTGATCACCACAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178752.3-731s21c1
Sequence:CCGGCGGATGCAAAGGGAACCTAAACTCGAGTTTAGGTTCCCTTTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178752.3-2424s21c1
Sequence:CCGGTCACACCGAATCTAGTCTTATCTCGAGATAAGACTAGATTCGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178752.3-1175s1c1
Sequence:CCGGGAGATTGCACATAACTTATTTCTCGAGAAATAAGTTATGTGCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178752.3-1115s21c1
Sequence:CCGGCCGGATTTGGAAGTGTTAATTCTCGAGAATTAACACTTCCAAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178752.3-472s21c1
Sequence:CCGGCGTGGACACAGTACCACTATCCTCGAGGATAGTGGTACTGTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178752
GDPGP1 MISSION shRNA shRNA Plasmid DNA
GDP-D-glucose phosphorylase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178752.2-2975s1c1
Sequence:CCGGGCTACCATCAAACTCCTCAAACTCGAGTTTGAGGAGTTTGATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178752.2-3926s1c1
Sequence:CCGGGCTCATCAGTTAAGATTGATTCTCGAGAATCAATCTTAACTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178752.2-737s1c1
Sequence:CCGGCGGATGCAAAGGGAACCTAAACTCGAGTTTAGGTTCCCTTTGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178752.3-780s21c1
Sequence:CCGGACGTCCTTGTGGTGATCAATGCTCGAGCATTGATCACCACAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178752.3-731s21c1
Sequence:CCGGCGGATGCAAAGGGAACCTAAACTCGAGTTTAGGTTCCCTTTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178752.3-2424s21c1
Sequence:CCGGTCACACCGAATCTAGTCTTATCTCGAGATAAGACTAGATTCGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178752.3-1175s1c1
Sequence:CCGGGAGATTGCACATAACTTATTTCTCGAGAAATAAGTTATGTGCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178752.3-1115s21c1
Sequence:CCGGCCGGATTTGGAAGTGTTAATTCTCGAGAATTAACACTTCCAAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178752.3-472s21c1
Sequence:CCGGCGTGGACACAGTACCACTATCCTCGAGGATAGTGGTACTGTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178752
GDPGP1 MISSION shRNA Lentiviral Transduction Particles
GDP-D-glucose phosphorylase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178752.2-2975s1c1
Sequence:CCGGGCTACCATCAAACTCCTCAAACTCGAGTTTGAGGAGTTTGATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191564    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178752.2-3926s1c1
Sequence:CCGGGCTCATCAGTTAAGATTGATTCTCGAGAATCAATCTTAACTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178752.2-737s1c1
Sequence:CCGGCGGATGCAAAGGGAACCTAAACTCGAGTTTAGGTTCCCTTTGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178752.3-780s21c1
Sequence:CCGGACGTCCTTGTGGTGATCAATGCTCGAGCATTGATCACCACAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178752.3-731s21c1
Sequence:CCGGCGGATGCAAAGGGAACCTAAACTCGAGTTTAGGTTCCCTTTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178752.3-2424s21c1
Sequence:CCGGTCACACCGAATCTAGTCTTATCTCGAGATAAGACTAGATTCGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178752.3-1175s1c1
Sequence:CCGGGAGATTGCACATAACTTATTTCTCGAGAAATAAGTTATGTGCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178752.3-1115s21c1
Sequence:CCGGCCGGATTTGGAAGTGTTAATTCTCGAGAATTAACACTTCCAAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178752.3-472s21c1
Sequence:CCGGCGTGGACACAGTACCACTATCCTCGAGGATAGTGGTACTGTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013657
GDPGP1 MISSION shRNA Bacterial Glycerol Stock
GDP-D-glucose phosphorylase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1615s1c1
Sequence:CCGGGAGATTGCTCATAACTTGTTTCTCGAGAAACAAGTTATGAGCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180840    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1744s1c1
Sequence:CCGGGCTTTCAATGTTGCCCTCTGTCTCGAGACAGAGGGCAACATTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149317    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1735s1c1
Sequence:CCGGGACGGTGAAGCTTTCAATGTTCTCGAGAACATTGAAAGCTTCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149104    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1713s1c1
Sequence:CCGGGAAGTCCAGCTTTGGGATAAACTCGAGTTTATCCCAAAGCTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1611s1c1
Sequence:CCGGCCATGAGATTGCTCATAACTTCTCGAGAAGTTATGAGCAATCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013657
GDPGP1 MISSION shRNA shRNA Plasmid DNA
GDP-D-glucose phosphorylase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1615s1c1
Sequence:CCGGGAGATTGCTCATAACTTGTTTCTCGAGAAACAAGTTATGAGCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180840    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1744s1c1
Sequence:CCGGGCTTTCAATGTTGCCCTCTGTCTCGAGACAGAGGGCAACATTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149317    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1735s1c1
Sequence:CCGGGACGGTGAAGCTTTCAATGTTCTCGAGAACATTGAAAGCTTCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149104    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1713s1c1
Sequence:CCGGGAAGTCCAGCTTTGGGATAAACTCGAGTTTATCCCAAAGCTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1611s1c1
Sequence:CCGGCCATGAGATTGCTCATAACTTCTCGAGAAGTTATGAGCAATCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013657
GDPGP1 MISSION shRNA Lentiviral Transduction Particles
GDP-D-glucose phosphorylase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1615s1c1
Sequence:CCGGGAGATTGCTCATAACTTGTTTCTCGAGAAACAAGTTATGAGCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180840    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1744s1c1
Sequence:CCGGGCTTTCAATGTTGCCCTCTGTCTCGAGACAGAGGGCAACATTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149317    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1735s1c1
Sequence:CCGGGACGGTGAAGCTTTCAATGTTCTCGAGAACATTGAAAGCTTCACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149104    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1713s1c1
Sequence:CCGGGAAGTCCAGCTTTGGGATAAACTCGAGTTTATCCCAAAGCTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013657.1-1611s1c1
Sequence:CCGGCCATGAGATTGCTCATAACTTCTCGAGAAGTTATGAGCAATCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks