EMAIL THIS PAGE TO A FRIEND

GEM

GTP binding protein overexpressed in skeletal muscle

Synonyms: KIR
UniProtKB ID: P55040, B2RA31
Gene ID:
Human(2669) Summary: The protein encoded by this gene belongs to the RAD/GEM family of GTP-binding proteins. It is associated with the inner face of the plasma membrane and could play a role as a regulatory protein in receptor-mediated signal transduction. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Mouse(14579) GTP binding protein (gene overexpressed in skeletal muscle)
Rat(297902) GTP binding protein overexpressed in skeletal muscle
Zebrafish(560566) GTP binding protein overexpressed in skeletal muscle
Thale Cress(816780) GLABRA2 expression modulator
chicken(404771) GTP binding protein overexpressed in skeletal muscle
dog(611634) GTP binding protein overexpressed in skeletal muscle
cow(538437) GTP binding protein overexpressed in skeletal muscle
domestic cat(101083484) GTP binding protein overexpressed in skeletal muscle
sheep(101109979) GTP binding protein overexpressed in skeletal muscle
domestic guinea pig(100716695) GTP binding protein overexpressed in skeletal muscle
naked mole-rat(101726155) GTP binding protein overexpressed in skeletal muscle
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010276 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010276 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010276 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005261 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049371 MISSION® esiRNA esiRNA human GEM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005261 Rosetta Predictions human pricing
NM_181702 Rosetta Predictions human pricing
NM_001106637 Rosetta Predictions rat pricing
NM_010276 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028799 predicted 1607
2 SASI_Hs01_00028800 predicted 1157
3 SASI_Hs02_00339292 predicted 1615
4 SASI_Hs01_00028802 predicted 1347
5 SASI_Hs01_00028803 predicted 1513
6 SASI_Hs01_00028805 predicted 1496
7 SASI_Hs01_00028806 predicted 1584
8 SASI_Hs01_00028807 predicted 1383
9 SASI_Hs01_00028808 predicted 749
10 SASI_Hs02_00339293 predicted 826
11 SASI_Hs01_00028801 predicted 1319
12 SASI_Hs01_00028804 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175584 predicted 1486
2 SASI_Hs01_00175585 predicted 1046
3 SASI_Hs02_00370301 predicted 1496
4 SASI_Hs01_00175587 predicted 1230
5 SASI_Hs01_00175588 predicted 1396
6 SASI_Hs01_00175590 predicted 1382
7 SASI_Hs01_00175591 predicted 1462
8 SASI_Hs01_00175592 predicted 1270
9 SASI_Hs01_00175593 predicted 634
10 SASI_Hs02_00370302 predicted 714
11 SASI_Hs01_00175586 predicted 1209
12 SASI_Hs01_00175589 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220908 predicted 1196
2 SASI_Rn02_00220909 predicted 1217
3 SASI_Rn02_00220910 predicted 1411
4 SASI_Rn02_00220911 predicted 713
5 SASI_Rn02_00220912 predicted 678
6 SASI_Rn02_00220913 predicted 330
7 SASI_Rn02_00220914 predicted 1389
8 SASI_Rn02_00220915 predicted 363
9 SASI_Rn02_00220916 predicted 1106
10 SASI_Rn02_00220917 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197984 predicted 406
2 SASI_Mm01_00197985 predicted 761
3 SASI_Mm01_00197986 predicted 1252
4 SASI_Mm02_00318202 predicted 1259
5 SASI_Mm01_00197987 predicted 1433
6 SASI_Mm01_00197988 predicted 683
7 SASI_Mm01_00197989 predicted 1381
8 SASI_Mm01_00197991 predicted 1128
9 SASI_Mm01_00197992 predicted 1217
10 SASI_Mm01_00197993 predicted 1126
11 SASI_Mm01_00197990 predicted 1165
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010276
GEM MISSION shRNA Bacterial Glycerol Stock
GTP binding protein overexpressed in skeletal muscle
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010276.4-1340s21c1
Sequence:CCGGTCGAGGTCCTTGGGTCATATACTCGAGTATATGACCCAAGGACCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010276.4-668s21c1
Sequence:CCGGCAGAAGACATTCCTATAATTTCTCGAGAAATTATAGGAATGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010276.4-708s21c1
Sequence:CCGGCTTAGTGCGGTGTCGAGAAGTCTCGAGACTTCTCGACACCGCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010276.4-1065s21c1
Sequence:CCGGTATTGGGACCAGTGATCTATACTCGAGTATAGATCACTGGTCCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010276.4-1450s21c1
Sequence:CCGGCATCACAGTTGTGACTATTTCCTCGAGGAAATAGTCACAACTGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010276.1-1638s1c1
Sequence:CCGGGCCAAATTCTACTTAGTCAAACTCGAGTTTGACTAAGTAGAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010276.1-338s1c1
Sequence:CCGGCCTACTACCGAGTAGTGCTTACTCGAGTAAGCACTACTCGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010276.1-446s1c1
Sequence:CCGGGAGAAGATACATATGAGCGTACTCGAGTACGCTCATATGTATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010276.1-948s1c1
Sequence:CCGGCAACAAGAACATGGCTTTCAACTCGAGTTGAAAGCCATGTTCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010276.1-572s1c1
Sequence:CCGGCCTATCTGATCGTCTACTCTACTCGAGTAGAGTAGACGATCAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010276
GEM MISSION shRNA shRNA Plasmid DNA
GTP binding protein overexpressed in skeletal muscle
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010276.4-1340s21c1
Sequence:CCGGTCGAGGTCCTTGGGTCATATACTCGAGTATATGACCCAAGGACCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010276.4-668s21c1
Sequence:CCGGCAGAAGACATTCCTATAATTTCTCGAGAAATTATAGGAATGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010276.4-708s21c1
Sequence:CCGGCTTAGTGCGGTGTCGAGAAGTCTCGAGACTTCTCGACACCGCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010276.4-1065s21c1
Sequence:CCGGTATTGGGACCAGTGATCTATACTCGAGTATAGATCACTGGTCCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010276.4-1450s21c1
Sequence:CCGGCATCACAGTTGTGACTATTTCCTCGAGGAAATAGTCACAACTGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010276.1-1638s1c1
Sequence:CCGGGCCAAATTCTACTTAGTCAAACTCGAGTTTGACTAAGTAGAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010276.1-338s1c1
Sequence:CCGGCCTACTACCGAGTAGTGCTTACTCGAGTAAGCACTACTCGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010276.1-446s1c1
Sequence:CCGGGAGAAGATACATATGAGCGTACTCGAGTACGCTCATATGTATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010276.1-948s1c1
Sequence:CCGGCAACAAGAACATGGCTTTCAACTCGAGTTGAAAGCCATGTTCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010276.1-572s1c1
Sequence:CCGGCCTATCTGATCGTCTACTCTACTCGAGTAGAGTAGACGATCAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010276
GEM MISSION shRNA Lentiviral Transduction Particles
GTP binding protein overexpressed in skeletal muscle
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010276.4-1340s21c1
Sequence:CCGGTCGAGGTCCTTGGGTCATATACTCGAGTATATGACCCAAGGACCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010276.4-668s21c1
Sequence:CCGGCAGAAGACATTCCTATAATTTCTCGAGAAATTATAGGAATGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010276.4-708s21c1
Sequence:CCGGCTTAGTGCGGTGTCGAGAAGTCTCGAGACTTCTCGACACCGCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010276.4-1065s21c1
Sequence:CCGGTATTGGGACCAGTGATCTATACTCGAGTATAGATCACTGGTCCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010276.4-1450s21c1
Sequence:CCGGCATCACAGTTGTGACTATTTCCTCGAGGAAATAGTCACAACTGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010276.1-1638s1c1
Sequence:CCGGGCCAAATTCTACTTAGTCAAACTCGAGTTTGACTAAGTAGAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010276.1-338s1c1
Sequence:CCGGCCTACTACCGAGTAGTGCTTACTCGAGTAAGCACTACTCGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010276.1-446s1c1
Sequence:CCGGGAGAAGATACATATGAGCGTACTCGAGTACGCTCATATGTATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010276.1-948s1c1
Sequence:CCGGCAACAAGAACATGGCTTTCAACTCGAGTTGAAAGCCATGTTCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010276.1-572s1c1
Sequence:CCGGCCTATCTGATCGTCTACTCTACTCGAGTAGAGTAGACGATCAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005261
GEM MISSION shRNA Bacterial Glycerol Stock
GTP binding protein overexpressed in skeletal muscle
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005261.3-561s21c1
Sequence:CCGGGTGCTGGGAGAAGATACATATCTCGAGATATGTATCTTCTCCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005261.3-1609s21c1
Sequence:CCGGCATCAGAATCGTGACTATTATCTCGAGATAATAGTCACGATTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005261.3-502s21c1
Sequence:CCGGAGTCCACTCTGGCCAACATCTCTCGAGAGATGTTGGCCAGAGTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-1093s1c1
Sequence:CCGGGCCTTCAAGCTCAAGTCCAAACTCGAGTTTGGACTTGAGCTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-622s1c1
Sequence:CCGGGCAACGATTATACTCCTGGATCTCGAGATCCAGGAGTATAATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-1119s1c1
Sequence:CCGGCCATGACCTCTCTGTACTCTACTCGAGTAGAGTACAGAGAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-844s1c1
Sequence:CCGGCGAGAAGTGTCTGTATCAGAACTCGAGTTCTGATACAGACACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-791s1c1
Sequence:CCGGCAGAGGACATTCCCATAATTTCTCGAGAAATTATGGGAATGTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005261
GEM MISSION shRNA shRNA Plasmid DNA
GTP binding protein overexpressed in skeletal muscle
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005261.3-561s21c1
Sequence:CCGGGTGCTGGGAGAAGATACATATCTCGAGATATGTATCTTCTCCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005261.3-1609s21c1
Sequence:CCGGCATCAGAATCGTGACTATTATCTCGAGATAATAGTCACGATTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005261.3-502s21c1
Sequence:CCGGAGTCCACTCTGGCCAACATCTCTCGAGAGATGTTGGCCAGAGTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-1093s1c1
Sequence:CCGGGCCTTCAAGCTCAAGTCCAAACTCGAGTTTGGACTTGAGCTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-622s1c1
Sequence:CCGGGCAACGATTATACTCCTGGATCTCGAGATCCAGGAGTATAATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-1119s1c1
Sequence:CCGGCCATGACCTCTCTGTACTCTACTCGAGTAGAGTACAGAGAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-844s1c1
Sequence:CCGGCGAGAAGTGTCTGTATCAGAACTCGAGTTCTGATACAGACACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-791s1c1
Sequence:CCGGCAGAGGACATTCCCATAATTTCTCGAGAAATTATGGGAATGTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005261
GEM MISSION shRNA Lentiviral Transduction Particles
GTP binding protein overexpressed in skeletal muscle
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005261.3-561s21c1
Sequence:CCGGGTGCTGGGAGAAGATACATATCTCGAGATATGTATCTTCTCCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005261.3-1609s21c1
Sequence:CCGGCATCAGAATCGTGACTATTATCTCGAGATAATAGTCACGATTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005261.3-502s21c1
Sequence:CCGGAGTCCACTCTGGCCAACATCTCTCGAGAGATGTTGGCCAGAGTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-1093s1c1
Sequence:CCGGGCCTTCAAGCTCAAGTCCAAACTCGAGTTTGGACTTGAGCTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-622s1c1
Sequence:CCGGGCAACGATTATACTCCTGGATCTCGAGATCCAGGAGTATAATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-1119s1c1
Sequence:CCGGCCATGACCTCTCTGTACTCTACTCGAGTAGAGTACAGAGAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-844s1c1
Sequence:CCGGCGAGAAGTGTCTGTATCAGAACTCGAGTTCTGATACAGACACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005261.2-791s1c1
Sequence:CCGGCAGAGGACATTCCCATAATTTCTCGAGAAATTATGGGAATGTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks