EMAIL THIS PAGE TO A FRIEND

GEMIN2

gem (nuclear organelle) associated protein 2

74 Gene Product Result for
Synonyms: SIP1 SIP1-delta
Gene ID:
Human(8487) Summary: This gene encodes one of the proteins found in the SMN complex, which consists of several gemin proteins and the protein known as the survival of motor neuron protein. The SMN complex is localized to a subnuclear compartment called gems (gemini of coiled bodies) and is required for assembly of spliceosomal snRNPs and for pre-mRNA splicing. This protein interacts directly with the survival of motor neuron protein and it is required for formation of the SMN complex. A knockout mouse targeting the mouse homolog of this gene exhibited disrupted snRNP assembly and motor neuron degeneration. [provided by RefSeq, Aug 2011]
Mouse(66603) gem (nuclear organelle) associated protein 2
Rat(84404) gem (nuclear organelle) associated protein 2
Zebrafish(550271) gem (nuclear organelle) associated protein 2
chicken(423336) gem (nuclear organelle) associated protein 2
dog(610087) gem (nuclear organelle) associated protein 2
cow(510259) gem (nuclear organelle) associated protein 2
domestic cat(101083009) gem (nuclear organelle) associated protein 2
naked mole-rat(101715665) gem (nuclear organelle) associated protein 2
domestic guinea pig(100732674) gem (nuclear organelle) associated protein 2
sheep(101122894) gem (nuclear organelle) associated protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003616 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009182 Rosetta Predictions human pricing
NM_001009183 Rosetta Predictions human pricing
NM_003616 Rosetta Predictions human pricing
NM_053389 Rosetta Predictions rat pricing
NM_025656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305607 predicted 316
2 SASI_Hs01_00079995 predicted 210
3 SASI_Hs01_00079996 predicted 246
4 SASI_Hs01_00079997 predicted 249
5 SASI_Hs01_00079998 predicted 256
6 SASI_Hs01_00079999 predicted 254
7 SASI_Hs01_00080000 predicted 258
8 SASI_Hs01_00080001 predicted 206
9 SASI_Hs01_00080002 predicted 208
10 SASI_Hs01_00080003 predicted 260
11 SASI_Hs01_00079994 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305608 predicted 310
2 SASI_Hs01_00013981 predicted 206
3 SASI_Hs01_00013982 predicted 248
4 SASI_Hs01_00013983 predicted 254
5 SASI_Hs01_00013984 predicted 259
6 SASI_Hs01_00013985 predicted 249
7 SASI_Hs01_00013986 predicted 257
8 SASI_Hs01_00013987 predicted 199
9 SASI_Hs01_00013988 predicted 212
10 SASI_Hs01_00013989 predicted 258
11 SASI_Hs01_00013980 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335958 predicted 317
2 SASI_Hs01_00155020 predicted 212
3 SASI_Hs01_00155021 predicted 247
4 SASI_Hs01_00155022 predicted 248
5 SASI_Hs01_00155023 predicted 258
6 SASI_Hs01_00155024 predicted 252
7 SASI_Hs01_00155025 predicted 257
8 SASI_Hs01_00155026 predicted 198
9 SASI_Hs01_00155027 predicted 203
10 SASI_Hs01_00155028 predicted 267
11 SASI_Hs01_00155019 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053389 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034202 predicted 547
2 SASI_Rn01_00034203 predicted 278
3 SASI_Rn02_00265885 predicted 393
4 SASI_Rn01_00034205 predicted 834
5 SASI_Rn01_00034206 predicted 815
6 SASI_Rn01_00034207 predicted 799
7 SASI_Rn01_00034208 predicted 414
8 SASI_Rn01_00034209 predicted 437
9 SASI_Rn01_00034210 predicted 616
10 SASI_Rn02_00265886 predicted 615
11 SASI_Rn01_00034204 predicted 428
12 SASI_Rn01_00034211 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328778 predicted 441
2 SASI_Mm02_00328779 predicted 816
3 SASI_Mm02_00328780 predicted 404
4 SASI_Mm02_00328781 predicted 579
5 SASI_Mm02_00328782 predicted 546
6 SASI_Mm02_00328783 predicted 837
7 SASI_Mm02_00328784 predicted 612
8 SASI_Mm02_00328785 predicted 600
9 SASI_Mm02_00328786 predicted 436
10 SASI_Mm02_00328787 predicted 657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025656
VALIDATED
GEMIN2 MISSION shRNA Bacterial Glycerol Stock
gem (nuclear organelle) associated protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025656.1-590s1c1
Sequence:CCGGGCTTAGTATTGTAAGCAGAATCTCGAGATTCTGCTTACAATACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025656.1-842s1c1
Sequence:CCGGCTGCTTAGTTAGCAGGTATTTCTCGAGAAATACCTGCTAACTAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025656.1-726s1c1
Sequence:CCGGCCTTTATTACCTGAGGCTCATCTCGAGATGAGCCTCAGGTAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025656.1-582s1c1
Sequence:CCGGCCTCCTTTGCTTAGTATTGTACTCGAGTACAATACTAAGCAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025656.1-437s1c1
Sequence:CCGGGTTGGACAGTAATGTGGCAATCTCGAGATTGCCACATTACTGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025656.4-631s21c1
Sequence:CCGGGTCTTGGAATATCTAAGTAATCTCGAGATTACTTAGATATTCCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025656.4-119s21c1
Sequence:CCGGAGTTGATGCCACGGTTGTTACCTCGAGGTAACAACCGTGGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025656.4-578s21c1
Sequence:CCGGTTCCTCCTTTGCTTAGTATTGCTCGAGCAATACTAAGCAAAGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025656.4-907s21c1
Sequence:CCGGCCTAGGGATGGAAGATGATTCCTCGAGGAATCATCTTCCATCCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025656.4-544s21c1
Sequence:CCGGGAAAGCCCTGGGATCGATTATCTCGAGATAATCGATCCCAGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025656
VALIDATED
GEMIN2 MISSION shRNA shRNA Plasmid DNA
gem (nuclear organelle) associated protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025656.1-590s1c1
Sequence:CCGGGCTTAGTATTGTAAGCAGAATCTCGAGATTCTGCTTACAATACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025656.1-842s1c1
Sequence:CCGGCTGCTTAGTTAGCAGGTATTTCTCGAGAAATACCTGCTAACTAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025656.1-726s1c1
Sequence:CCGGCCTTTATTACCTGAGGCTCATCTCGAGATGAGCCTCAGGTAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025656.1-582s1c1
Sequence:CCGGCCTCCTTTGCTTAGTATTGTACTCGAGTACAATACTAAGCAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025656.1-437s1c1
Sequence:CCGGGTTGGACAGTAATGTGGCAATCTCGAGATTGCCACATTACTGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025656.4-631s21c1
Sequence:CCGGGTCTTGGAATATCTAAGTAATCTCGAGATTACTTAGATATTCCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025656.4-119s21c1
Sequence:CCGGAGTTGATGCCACGGTTGTTACCTCGAGGTAACAACCGTGGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025656.4-578s21c1
Sequence:CCGGTTCCTCCTTTGCTTAGTATTGCTCGAGCAATACTAAGCAAAGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025656.4-907s21c1
Sequence:CCGGCCTAGGGATGGAAGATGATTCCTCGAGGAATCATCTTCCATCCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025656.4-544s21c1
Sequence:CCGGGAAAGCCCTGGGATCGATTATCTCGAGATAATCGATCCCAGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025656
VALIDATED
GEMIN2 MISSION shRNA Lentiviral Transduction Particles
gem (nuclear organelle) associated protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025656.1-590s1c1
Sequence:CCGGGCTTAGTATTGTAAGCAGAATCTCGAGATTCTGCTTACAATACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025656.1-842s1c1
Sequence:CCGGCTGCTTAGTTAGCAGGTATTTCTCGAGAAATACCTGCTAACTAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025656.1-726s1c1
Sequence:CCGGCCTTTATTACCTGAGGCTCATCTCGAGATGAGCCTCAGGTAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025656.1-582s1c1
Sequence:CCGGCCTCCTTTGCTTAGTATTGTACTCGAGTACAATACTAAGCAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025656.1-437s1c1
Sequence:CCGGGTTGGACAGTAATGTGGCAATCTCGAGATTGCCACATTACTGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025656.4-631s21c1
Sequence:CCGGGTCTTGGAATATCTAAGTAATCTCGAGATTACTTAGATATTCCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025656.4-119s21c1
Sequence:CCGGAGTTGATGCCACGGTTGTTACCTCGAGGTAACAACCGTGGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025656.4-578s21c1
Sequence:CCGGTTCCTCCTTTGCTTAGTATTGCTCGAGCAATACTAAGCAAAGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025656.4-907s21c1
Sequence:CCGGCCTAGGGATGGAAGATGATTCCTCGAGGAATCATCTTCCATCCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025656.4-544s21c1
Sequence:CCGGGAAAGCCCTGGGATCGATTATCTCGAGATAATCGATCCCAGGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003616
VALIDATED
GEMIN2 MISSION shRNA Bacterial Glycerol Stock
gem (nuclear organelle) associated protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003616.1-423s1c1
Sequence:CCGGCGACAGAATGTGAACAAACATCTCGAGATGTTTGTTCACATTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003616.1-620s1c1
Sequence:CCGGGCTTAGTATTGTTAGCAGAATCTCGAGATTCTGCTAACAATACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003616.1-273s1c1
Sequence:CCGGCCAGATGTTGTGGTAGCTCAACTCGAGTTGAGCTACCACAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003616.1-872s1c1
Sequence:CCGGCTGCTTGGTTAGCAGGTATTTCTCGAGAAATACCTGCTAACCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003616.1-612s1c1
Sequence:CCGGCCTCCCTTGCTTAGTATTGTTCTCGAGAACAATACTAAGCAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003616.2-212s21c1
Sequence:CCGGCCAGATGTTGTGGTAGCTCAACTCGAGTTGAGCTACCACAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003616.2-811s21c1
Sequence:CCGGCTGCTTGGTTAGCAGGTATTTCTCGAGAAATACCTGCTAACCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003616.2-551s21c1
Sequence:CCGGCCTCCCTTGCTTAGTATTGTTCTCGAGAACAATACTAAGCAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003616.2-362s21c1
Sequence:CCGGCGACAGAATGTGAACAAACATCTCGAGATGTTTGTTCACATTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003616
VALIDATED
GEMIN2 MISSION shRNA shRNA Plasmid DNA
gem (nuclear organelle) associated protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003616.1-423s1c1
Sequence:CCGGCGACAGAATGTGAACAAACATCTCGAGATGTTTGTTCACATTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003616.1-620s1c1
Sequence:CCGGGCTTAGTATTGTTAGCAGAATCTCGAGATTCTGCTAACAATACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003616.1-273s1c1
Sequence:CCGGCCAGATGTTGTGGTAGCTCAACTCGAGTTGAGCTACCACAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003616.1-872s1c1
Sequence:CCGGCTGCTTGGTTAGCAGGTATTTCTCGAGAAATACCTGCTAACCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003616.1-612s1c1
Sequence:CCGGCCTCCCTTGCTTAGTATTGTTCTCGAGAACAATACTAAGCAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003616.2-212s21c1
Sequence:CCGGCCAGATGTTGTGGTAGCTCAACTCGAGTTGAGCTACCACAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003616.2-811s21c1
Sequence:CCGGCTGCTTGGTTAGCAGGTATTTCTCGAGAAATACCTGCTAACCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003616.2-551s21c1
Sequence:CCGGCCTCCCTTGCTTAGTATTGTTCTCGAGAACAATACTAAGCAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003616.2-362s21c1
Sequence:CCGGCGACAGAATGTGAACAAACATCTCGAGATGTTTGTTCACATTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003616
VALIDATED
GEMIN2 MISSION shRNA Lentiviral Transduction Particles
gem (nuclear organelle) associated protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003616.1-423s1c1
Sequence:CCGGCGACAGAATGTGAACAAACATCTCGAGATGTTTGTTCACATTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003616.1-620s1c1
Sequence:CCGGGCTTAGTATTGTTAGCAGAATCTCGAGATTCTGCTAACAATACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003616.1-273s1c1
Sequence:CCGGCCAGATGTTGTGGTAGCTCAACTCGAGTTGAGCTACCACAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003616.1-872s1c1
Sequence:CCGGCTGCTTGGTTAGCAGGTATTTCTCGAGAAATACCTGCTAACCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003616.1-612s1c1
Sequence:CCGGCCTCCCTTGCTTAGTATTGTTCTCGAGAACAATACTAAGCAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003616.2-212s21c1
Sequence:CCGGCCAGATGTTGTGGTAGCTCAACTCGAGTTGAGCTACCACAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003616.2-811s21c1
Sequence:CCGGCTGCTTGGTTAGCAGGTATTTCTCGAGAAATACCTGCTAACCAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003616.2-551s21c1
Sequence:CCGGCCTCCCTTGCTTAGTATTGTTCTCGAGAACAATACTAAGCAAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003616.2-362s21c1
Sequence:CCGGCGACAGAATGTGAACAAACATCTCGAGATGTTTGTTCACATTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks