EMAIL THIS PAGE TO A FRIEND

GEMIN4

gem (nuclear organelle) associated protein 4

55 Gene Product Result for
Synonyms: HC56 HCAP1 HHRF-1 p97
UniProtKB ID: P57678, Q9NZS7, Q9UG32, Q9Y4Q2
Gene ID:
Human(50628) Summary: The product of this gene is part of a large complex localized to the cytoplasm, nucleoli, and to discrete nuclear bodies called Gemini bodies (gems). The complex functions in spliceosomal snRNP assembly in the cytoplasm, and regenerates spliceosomes required for pre-mRNA splicing in the nucleus. The encoded protein directly interacts with a DEAD box protein and several spliceosome core proteins. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(276919) gem (nuclear organelle) associated protein 4
Rat(497958) gem (nuclear organelle) associated protein 4
sheep(101114120) gem (nuclear organelle) associated protein 4
domestic guinea pig(100714949) gem (nuclear organelle) associated protein 4
naked mole-rat(101712785) gem (nuclear organelle) associated protein 4
Zebrafish(324754) gem (nuclear organelle) associated protein 4
cow(539147) gem (nuclear organelle) associated protein 4
Horse(100059900) gem (nuclear organelle) associated protein 4
domestic cat(101088375) gem (nuclear organelle) associated protein 4
dog(611189) gem (nuclear organelle) associated protein 4
chicken(427835) gem (nuclear organelle) associated protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015721 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015721 Rosetta Predictions human pricing
NM_001109037 Rosetta Predictions rat pricing
NM_177367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071973 predicted 1920
2 SASI_Hs02_00348408 predicted 3372
3 SASI_Hs01_00071976 predicted 1168
4 SASI_Hs01_00071977 predicted 2778
5 SASI_Hs01_00071979 predicted 2931
6 SASI_Hs01_00071980 predicted 319
7 SASI_Hs02_00348409 predicted 2074
8 SASI_Hs01_00071981 predicted 2127
9 SASI_Hs01_00071982 predicted 845
10 SASI_Hs02_00348410 predicted 475
11 SASI_Hs01_00071974 predicted 2782
12 SASI_Hs01_00071975 predicted 762
13 SASI_Hs01_00071978 predicted 2373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244554 predicted 1401
2 SASI_Rn02_00244555 predicted 1413
3 SASI_Rn02_00244556 predicted 1440
4 SASI_Rn02_00244557 predicted 1144
5 SASI_Rn02_00244558 predicted 703
6 SASI_Rn02_00244559 predicted 1157
7 SASI_Rn02_00244560 predicted 3052
8 SASI_Rn02_00244561 predicted 754
9 SASI_Rn02_00244562 predicted 2132
10 SASI_Rn02_00244563 predicted 1590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347522 predicted 1808
2 SASI_Mm01_00183786 predicted 1371
3 SASI_Mm01_00183787 predicted 1601
4 SASI_Mm01_00183790 predicted 382
5 SASI_Mm01_00183791 predicted 1443
6 SASI_Mm01_00183792 predicted 1896
7 SASI_Mm01_00183793 predicted 1842
8 SASI_Mm02_00347523 predicted 701
9 SASI_Mm01_00183794 predicted 423
10 SASI_Mm02_00347524 predicted 747
11 SASI_Mm01_00183788 predicted 2662
12 SASI_Mm01_00183789 predicted 712
13 SASI_Mm01_00183795 predicted 2563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177367
VALIDATED
GEMIN4 MISSION shRNA Bacterial Glycerol Stock
gem (nuclear organelle) associated protein 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177367.3-1477s21c1
Sequence:CCGGCATCAGCTCTGATCGGGTTATCTCGAGATAACCCGATCAGAGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177367.3-1299s21c1
Sequence:CCGGCCATTGCCATGGCCATCATTGCTCGAGCAATGATGGCCATGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177367.3-1657s21c1
Sequence:CCGGAGACCTCAACACGACGTTTAACTCGAGTTAAACGTCGTGTTGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177367.2-1444s1c1
Sequence:CCGGGCCTCAGATCAAGCAGGTAATCTCGAGATTACCTGCTTGATCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177367.2-2306s1c1
Sequence:CCGGCGCAAATTAGACCAGCTAGATCTCGAGATCTAGCTGGTCTAATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177367.2-616s1c1
Sequence:CCGGCCATCCTCCAAAGAGGTTTAACTCGAGTTAAACCTCTTTGGAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177367.2-3258s1c1
Sequence:CCGGCCCAGAGCTAAGAACAAACAACTCGAGTTGTTTGTTCTTAGCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177367.2-755s1c1
Sequence:CCGGGCTGACATGCTGAGTGTGTTTCTCGAGAAACACACTCAGCATGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177367
VALIDATED
GEMIN4 MISSION shRNA shRNA Plasmid DNA
gem (nuclear organelle) associated protein 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177367.3-1477s21c1
Sequence:CCGGCATCAGCTCTGATCGGGTTATCTCGAGATAACCCGATCAGAGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177367.3-1299s21c1
Sequence:CCGGCCATTGCCATGGCCATCATTGCTCGAGCAATGATGGCCATGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177367.3-1657s21c1
Sequence:CCGGAGACCTCAACACGACGTTTAACTCGAGTTAAACGTCGTGTTGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177367.2-1444s1c1
Sequence:CCGGGCCTCAGATCAAGCAGGTAATCTCGAGATTACCTGCTTGATCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177367.2-2306s1c1
Sequence:CCGGCGCAAATTAGACCAGCTAGATCTCGAGATCTAGCTGGTCTAATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177367.2-616s1c1
Sequence:CCGGCCATCCTCCAAAGAGGTTTAACTCGAGTTAAACCTCTTTGGAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177367.2-3258s1c1
Sequence:CCGGCCCAGAGCTAAGAACAAACAACTCGAGTTGTTTGTTCTTAGCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177367.2-755s1c1
Sequence:CCGGGCTGACATGCTGAGTGTGTTTCTCGAGAAACACACTCAGCATGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177367
VALIDATED
GEMIN4 MISSION shRNA Lentiviral Transduction Particles
gem (nuclear organelle) associated protein 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177367.3-1477s21c1
Sequence:CCGGCATCAGCTCTGATCGGGTTATCTCGAGATAACCCGATCAGAGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177367.3-1299s21c1
Sequence:CCGGCCATTGCCATGGCCATCATTGCTCGAGCAATGATGGCCATGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177367.3-1657s21c1
Sequence:CCGGAGACCTCAACACGACGTTTAACTCGAGTTAAACGTCGTGTTGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177367.2-1444s1c1
Sequence:CCGGGCCTCAGATCAAGCAGGTAATCTCGAGATTACCTGCTTGATCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177367.2-2306s1c1
Sequence:CCGGCGCAAATTAGACCAGCTAGATCTCGAGATCTAGCTGGTCTAATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177367.2-616s1c1
Sequence:CCGGCCATCCTCCAAAGAGGTTTAACTCGAGTTAAACCTCTTTGGAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177367.2-3258s1c1
Sequence:CCGGCCCAGAGCTAAGAACAAACAACTCGAGTTGTTTGTTCTTAGCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177367.2-755s1c1
Sequence:CCGGGCTGACATGCTGAGTGTGTTTCTCGAGAAACACACTCAGCATGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015721
VALIDATED
GEMIN4 MISSION shRNA Bacterial Glycerol Stock
gem (nuclear organelle) associated protein 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015721.2-207s21c1
Sequence:CCGGGCACTGGCAGAATTAACAAAGCTCGAGCTTTGTTAATTCTGCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015721.2-3205s21c1
Sequence:CCGGCACACGAGCAGCGCTTCTTAACTCGAGTTAAGAAGCGCTGCTCGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-3321s1c1
Sequence:CCGGCAGCCTGGACTTTACAGTTATCTCGAGATAACTGTAAAGTCCAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-2791s1c1
Sequence:CCGGGCAGCCATAGCTGTCGTAATTCTCGAGAATTACGACAGCTATGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-557s1c1
Sequence:CCGGGCTCTCCCAGTTTAGTGCAATCTCGAGATTGCACTAAACTGGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-807s1c1
Sequence:CCGGGCAACCGTGTATCTGGACAAACTCGAGTTTGTCCAGATACACGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-2951s1c1
Sequence:CCGGGTTTGTTTACACCCAGGTGTTCTCGAGAACACCTGGGTGTAAACAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015721
VALIDATED
GEMIN4 MISSION shRNA shRNA Plasmid DNA
gem (nuclear organelle) associated protein 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015721.2-207s21c1
Sequence:CCGGGCACTGGCAGAATTAACAAAGCTCGAGCTTTGTTAATTCTGCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015721.2-3205s21c1
Sequence:CCGGCACACGAGCAGCGCTTCTTAACTCGAGTTAAGAAGCGCTGCTCGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-3321s1c1
Sequence:CCGGCAGCCTGGACTTTACAGTTATCTCGAGATAACTGTAAAGTCCAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-2791s1c1
Sequence:CCGGGCAGCCATAGCTGTCGTAATTCTCGAGAATTACGACAGCTATGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-557s1c1
Sequence:CCGGGCTCTCCCAGTTTAGTGCAATCTCGAGATTGCACTAAACTGGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-807s1c1
Sequence:CCGGGCAACCGTGTATCTGGACAAACTCGAGTTTGTCCAGATACACGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-2951s1c1
Sequence:CCGGGTTTGTTTACACCCAGGTGTTCTCGAGAACACCTGGGTGTAAACAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015721
VALIDATED
GEMIN4 MISSION shRNA Lentiviral Transduction Particles
gem (nuclear organelle) associated protein 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015721.2-207s21c1
Sequence:CCGGGCACTGGCAGAATTAACAAAGCTCGAGCTTTGTTAATTCTGCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015721.2-3205s21c1
Sequence:CCGGCACACGAGCAGCGCTTCTTAACTCGAGTTAAGAAGCGCTGCTCGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-3321s1c1
Sequence:CCGGCAGCCTGGACTTTACAGTTATCTCGAGATAACTGTAAAGTCCAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-2791s1c1
Sequence:CCGGGCAGCCATAGCTGTCGTAATTCTCGAGAATTACGACAGCTATGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-557s1c1
Sequence:CCGGGCTCTCCCAGTTTAGTGCAATCTCGAGATTGCACTAAACTGGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-807s1c1
Sequence:CCGGGCAACCGTGTATCTGGACAAACTCGAGTTTGTCCAGATACACGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015721.1-2951s1c1
Sequence:CCGGGTTTGTTTACACCCAGGTGTTCTCGAGAACACCTGGGTGTAAACAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks